Hi, I'm afraid your MG-RAST job (1287, waste water) has failed. The sequence file does not conform to the fasta format, with some extra lines at the top (below). Also, The system requires the sequence file name end in .fa, .fasta, .fas, .fsa or .fna. FT CDS 92..1945 FT CDS complement(2798..3196) FT CDS complement(3346..3654)

Fosmid_M1 tccgcgaggtttcctcgaccgtctgatcgggacggaactgcgagatggccgcaagtgcga tgccgatcggagcaccggtcgcattgttgttttggc

Please resubmit a modified sequence file. Thanks, Mark D'Souza -- for the MG-RAST team