Thanks for using MG-RAST. You need to send the COG proteins to the workbench. http://blog.metagenomics.anl.gov/howto/using-the-workbench/ On the workbench page, below the table, is a button labeled download metagenome dna FASTA annotated by COG, which generates a fasta file like this:

4440275.3|228555_3152_1807|COG|COG0489 ATPases involved in chromosome partitioning catctaataaagcaacatcttgaggtgttgaatacaataacagcacccgctaaatttact tgttgtgccaatgatatctgtatatctccagtcccaggtggaagatcaataataattata tctaaattgccccatgctacagaatttagcatttgagttaaggcagactgtaccataggt cctcgccaaatcattgctgtgtcgtcaggaactaatagccccatagacatcaaacttatt cctaaaa 4440275.3|318862_2493_3356|COG|COG1192 ATPases involved in chromosome partitioning ggcactcacgttgagccccgatttatacaaaaaacagatattgaaaatatcgatcttgtc

containing the sequences that had similarity matches. I hope this helps. William Trimble for the MG-RAST team ---------- Forwarded message ---------- From: <[email protected]> Date: Mon, Jun 27, 2011 at 3:23 AM Subject: [mg-rast] request To: [email protected] Dear Sir/Madam,**** ** ** Sorry to bother you . **** I am using COG analysis in MG-RAST, for example, I have got the information below:**** metagenome**** level 1**** level 2**** function**** id**** abundance**** avg eValue**** avg % ident**** avg align len**** # proteins**** *4448084.3* *CELLULAR PROCESSES AND SIGNALING* *Cell cycle control, cell division, chromosome partitioning * *Integral membrane protein possibly involved in chromosome condensation* *COG0239* *112* *-12.5* *74.38* *48.79* *14* ** ** My question is whether I can get the information about which reads of the 454 sequences are assigned to COG0239?**** ** ** Thank you in advance,**** ** ** Regards,**** Dongmei**** ** ** *Dr. Dongmei Li* Research Scientist*|* MEOR CSIRO Food & Nutritional Sciences**** Phone: +61 2 9490 5078* | *Fax: +61 2 9490 5010 [email protected] *|* www.csiro.au *|* www.csiro.au/CFNS Address: 11 Julius Ave. North Ryde,NSW 2113 **** *PLEASE NOTE* The information contained in this email may be confidential or privileged. Any unauthorised use or disclosure is prohibited. If you have received this email in error, please delete it immediately and notify the sender by return email. Thank you. To the extent permitted by law, CSIRO does not represent, warrant and/or guarantee that the integrity of this communication has been maintained or that the communication is free of errors, virus, interception or interference. **** *Please consider the environment before printing this email.***** ** **