November 2007 - Mg-rast - mailman3.cels.anl.gov

mg-rast meta nodeValue error
by Rob Edwards 25 Nov '07

25 Nov '07

I have a couple of jobs that have this error: Can't call method "nodeValue" on an undefined value at /vol/ metagenome-48-hour/FIGdisk.prod/dist/releases/dev/cee/lib/ FigKernelPackages/GenomeMeta.pm line 398 any idea what the fix is? e.g. http://metagenomics.theseed.org/?page=JobDebugger&job=147 Thanks Rob

1 0

Re: mg-rast problem
by Jeremy Koenig 21 Nov '07

21 Nov '07

Hi Rob, Seems there's a glitch in the matrix.... Thanks for picking that up. -JK On Nov 21, 2007 10:47 PM, Rob Edwards <redwards(a)mcs.anl.gov> wrote: > Jeremy > > Some of your data is badly formatted. For example, this sequence > > > >jk_TAR6GC_0004a03 , 14 to 210 rc (length = 197) 480 bp > ggcgttaggccgcagacggcaaggtcttggcaaaagcacgtggcgtacgctcaagagctt > ctctgatccaccctcgcccaggctccggcataactcaaacccgttatgcctccgcctggt > gataggctcgcgtggtcaacgcgatttccgcattcaggttgggcaggcaaagagcgcggg > gtcagcggtctaacaagjk_TARGC_e,torc(length=)agcgttaggccgcagatgg > cagaccaagagaaagcgggaaaaccggctgacgtcttcgccagactgatctgccttggca > tctttctcacaatggctgcatgcgcctatctgtctcacgccacttggggcctggacgtca > gaacctatggcttcagccttctggccattactatgcttttcatcgggacaatcgcgccag > cttctactcgtgcaggcgtcgtcgcattctttccatgggtctaggtctgcggctaacaat > > appears to be the concatenation of two sequences. > > There are several of these in the input file. > > > Rob > > > On Nov 21, 2007, at 6:26 PM, Jeremy Koenig wrote: > > > Hi, > > > > My job to MGRAST seems to have a problem the job number is 198 > > > > Thanks for your time. > > > > -JK > > > >

1 0

Re: mg-rast problem
by Rob Edwards 21 Nov '07

21 Nov '07

Jeremy Some of your data is badly formatted. For example, this sequence >jk_TAR6GC_0004a03 , 14 to 210 rc (length = 197) 480 bp ggcgttaggccgcagacggcaaggtcttggcaaaagcacgtggcgtacgctcaagagctt ctctgatccaccctcgcccaggctccggcataactcaaacccgttatgcctccgcctggt gataggctcgcgtggtcaacgcgatttccgcattcaggttgggcaggcaaagagcgcggg gtcagcggtctaacaagjk_TARGC_e,torc(length=)agcgttaggccgcagatgg cagaccaagagaaagcgggaaaaccggctgacgtcttcgccagactgatctgccttggca tctttctcacaatggctgcatgcgcctatctgtctcacgccacttggggcctggacgtca gaacctatggcttcagccttctggccattactatgcttttcatcgggacaatcgcgccag cttctactcgtgcaggcgtcgtcgcattctttccatgggtctaggtctgcggctaacaat appears to be the concatenation of two sequences. There are several of these in the input file. Rob On Nov 21, 2007, at 6:26 PM, Jeremy Koenig wrote: > Hi, > > My job to MGRAST seems to have a problem the job number is 198 > > Thanks for your time. > > -JK >

1 0

mg-rast problem
by Jeremy Koenig 21 Nov '07

21 Nov '07

Hi, My job to MGRAST seems to have a problem the job number is 198 Thanks for your time. -JK

1 0

Re: mg-rast died
by Robert Olson 13 Nov '07

13 Nov '07

Hrm, I wonder if something new is going on that is corrupting the files. These files are coming up with a stray > at the very end, a different failure than we have had in the past. Has the production MG code changed at all in the last day or two? --bob On Nov 13, 2007, at 4:21 PM, Rob Edwards wrote: > I'm still getting the error. > > Rob > > > On Nov 13, 2007, at 12:55 PM, Robert Olson wrote: > >> fixed. >> hm, we haven't seen that in a long time. >> >> On Nov 13, 2007, at 2:52 PM, Rob Edwards wrote: >> >>> >>> >>> http://metagenomics.theseed.org/rast.cgi?page=Jobs >>> >>> >>> Error reading /vol/metagenome-48-hour/Jobs.prod/147/meta.xml: >>> Entity: line 560: parser error : Extra content at the end of the >>> document > ^ at /vol/metagenome-48-hour/FIGdisk.prod/dist/ >>> releases/dev/cee/lib/FigKernelPackages/GenomeMeta.pm line 86 >>> >>> Rob >>> >>> >> >

1 0

Re: mg-rast died
by Rob Edwards 13 Nov '07

13 Nov '07

I'm still getting the error. Rob On Nov 13, 2007, at 12:55 PM, Robert Olson wrote: > fixed. > hm, we haven't seen that in a long time. > > On Nov 13, 2007, at 2:52 PM, Rob Edwards wrote: > >> >> >> http://metagenomics.theseed.org/rast.cgi?page=Jobs >> >> >> Error reading /vol/metagenome-48-hour/Jobs.prod/147/meta.xml: >> Entity: line 560: parser error : Extra content at the end of the >> document > ^ at /vol/metagenome-48-hour/FIGdisk.prod/dist/releases/ >> dev/cee/lib/FigKernelPackages/GenomeMeta.pm line 86 >> >> Rob >> >> >

1 0

Re: mg-rast died
by Robert Olson 13 Nov '07

13 Nov '07

fixed. hm, we haven't seen that in a long time. On Nov 13, 2007, at 2:52 PM, Rob Edwards wrote: > > > http://metagenomics.theseed.org/rast.cgi?page=Jobs > > > Error reading /vol/metagenome-48-hour/Jobs.prod/147/meta.xml: > Entity: line 560: parser error : Extra content at the end of the > document > ^ at /vol/metagenome-48-hour/FIGdisk.prod/dist/releases/ > dev/cee/lib/FigKernelPackages/GenomeMeta.pm line 86 > > Rob > >

1 0

mg-rast died
by Rob Edwards 13 Nov '07

13 Nov '07

http://metagenomics.theseed.org/rast.cgi?page=Jobs Error reading /vol/metagenome-48-hour/Jobs.prod/147/meta.xml: Entity: line 560: parser error : Extra content at the end of the document > ^ at /vol/metagenome-48-hour/FIGdisk.prod/dist/releases/dev/cee/lib/ FigKernelPackages/GenomeMeta.pm line 86 Rob

1 0

Re: mg-rast questions about SEED annotation
by Rob Edwards 12 Nov '07

12 Nov '07

The BLAST versus the SEED is blastx and only has protein sequences. i.e. doesn't give you hits against the 16S genes. Rob On Nov 12, 2007, at 9:04 AM, <quani(a)uiuc.edu> wrote: > Hi, > > I am the user of SEED-based annotation service and have a question > about it. My sample Genome ID is 4440283.3 and name is Chicken > cecum A. When I tried to get taxonomic classification, I understand > that blast Vs SEED gives all the proteins in the SEED database > (will those hits include 16s RDNA hits and EGT (coding sequence) > hits). And when I choose 16s choices, then the comparison is only > give my 16s hits classification. In that case, how can I just get > only the classification of the coding sequence. > > thank you so much for your help > > Ani >

1 0

mg-rast questions about SEED annotation
by quani＠uiuc.edu 12 Nov '07

12 Nov '07

Hi, I am the user of SEED-based annotation service and have a question about it. My sample Genome ID is 4440283.3 and name is Chicken cecum A. When I tried to get taxonomic classification, I understand that blast Vs SEED gives all the proteins in the SEED database (will those hits include 16s RDNA hits and EGT (coding sequence) hits). And when I choose 16s choices, then the comparison is only give my 16s hits classification. In that case, how can I just get only the classification of the coding sequence. thank you so much for your help Ani

1 0