May 2009 - Mg-rast - mailman3.cels.anl.gov

failed jobs
by Robert Olson 31 May '09

31 May '09

do you know what's going on with teh failed mgrast jobs? at a guess I'd say mg-rast is getting NFS-swamped and nodes are losing the mount; moving to the lustre volume asap is probably the solution there. --bob, with another 5000 mail messages in his inbox from SGE

1 0

Re: [mg-rast] SEED organism directory creation
by Folker Meyer 29 May '09

29 May '09

Gerhard, we will take a look at this soon. We are working on the next version that will allow even more downloads and make a lot of things easier. Best, Folker On May 28, 2009, at 11:20 AM, Gerhard Thallinger wrote: > Hi Folker, > >> We will take a look at this and get back to you. > > Two of my jobs (3474 and 3475) have now completed due to your > intervention. Thanks a lot. The two other jobes (3476 and 3477) > still seem to be stalled. Could you have a look on them ? > > I have two additional questions: > - Is it possible to download all sequences identified as 16S related > at > once ? I found only the possibility to download them based on a > certain taxonomic classification. > - The Metagenome Overview for GG01_LXR (4443525.3) shows a total > of 254 16S sequences (234+20). In the Phylogenetic Profile (RDP) > 345 classified 16s sequences are shown. Where does the difference > come from ? What classification are the numbers in the overview > based on ? > > Thanks in advance for your help > > Regards > > Gerhard Thallinger > > ------------------------------------------------------------------------ > Dr. Gerhard Thallinger E-mail: Gerhard.Thallinger(a)tugraz.at > Institute for Genomics and Bioinformatics Web: http://genome.tugraz.at > Graz University of Technology Tel: +43 316 873 > 5343 > Petersgasse 14/V Fax: +43 316 873 > 105343 > 8010 Graz, Austria Map: http://genome.tugraz.at/Loc.html >

1 0

Your MG-RAST job submissions (3524, 3527, 3529, 3533, 3535, 3537, 3538, 3539, 3541, 3543, 3544, 3547, 3548, 3550)
by Alex Rodriguez 29 May '09

29 May '09

Hi, I'm afraid your submissions to MG-RAST have failed as the sequence file does not conform to fasta standard. They start with an id line but it is not a fasta sequence: FQCPN2T01BVXM7 >FPZU02C13PGYB4_185 ATTACCAAAAGCTACCCACGTAGGGGGCTGGTCGGAATACCGCCCGGCTGTGTGAAAGACTGCGCAGAAGGCGTCGAACCACCATAGGAGCCAGGATCAACAGAAGACGTCTGAATACCTCCGACATCAGCGTAGGGAGTGAGCCCGGCCGCAACACGCGCTCGACGCTGAGCGGC CGGGGAATT Please correct the files and resubmit. Regards, Alex Rodriguez -- for the MG-RAST team

1 0

course
by Rob Edwards 29 May '09

29 May '09

All, I'm going to be teaching a course on mg-rast from June 15-19. I don't think there are going to be any special requirements, and I can't forsee any unusual problems, but I thought I'd give you a heads up, just in case. It would be nice, but certainly not essential, if there were no major updates that week :) Rob

1 0

Re: [mg-rast] is mg-rast ok?
by Alex Rodriguez 29 May '09

29 May '09

I'll restart the jobs this morning. Alex On May 29, 2009, at 2:34 AM, Rob Edwards wrote: > We have 436 jobs in the error state at the moment. > > Jobs have been erroring for > 1 week. > > I assume we ran out of disk space (stupid SEED directory part, > probably). > > Can someone investigate...? > > Rob

1 0

is mg-rast ok?
by Rob Edwards 29 May '09

29 May '09

We have 436 jobs in the error state at the moment. Jobs have been erroring for > 1 week. I assume we ran out of disk space (stupid SEED directory part, probably). Can someone investigate...? Rob

1 0

Re: [mg-rast] SEED organism directory creation
by Gerhard Thallinger 28 May '09

28 May '09

Hi Folker, > We will take a look at this and get back to you. Two of my jobs (3474 and 3475) have now completed due to your intervention. Thanks a lot. The two other jobes (3476 and 3477) still seem to be stalled. Could you have a look on them ? I have two additional questions: - Is it possible to download all sequences identified as 16S related at once ? I found only the possibility to download them based on a certain taxonomic classification. - The Metagenome Overview for GG01_LXR (4443525.3) shows a total of 254 16S sequences (234+20). In the Phylogenetic Profile (RDP) 345 classified 16s sequences are shown. Where does the difference come from ? What classification are the numbers in the overview based on ? Thanks in advance for your help Regards Gerhard Thallinger ------------------------------------------------------------------------ Dr. Gerhard Thallinger E-mail: Gerhard.Thallinger(a)tugraz.at Institute for Genomics and Bioinformatics Web: http://genome.tugraz.at Graz University of Technology Tel: +43 316 873 5343 Petersgasse 14/V Fax: +43 316 873 105343 8010 Graz, Austria Map: http://genome.tugraz.at/Loc.html

1 0

how to fix up sims tasks that failed to load
by Robert Olson 26 May '09

26 May '09

the following sequence will cause incompletely-loaded sims tasks to restart from scratch: bash-3.2$ reset_sims_load /vol/mg-rast-prod/jobs/3464 Running job! /vol/mg-rast-prod/jobs/3464 Updated 15 jobs Please run get_sim_status -resubmit /vol/mg-rast-prod/jobs/3464 bash-3.2$ get_sim_status /vol/mg-rast-prod/jobs/3464 Need to rerun sims.seed: 6727 6735 6783 6795-6796 6803 6807-6808 Need to rerun sims.gg: 19 28-31 44 46 bash-3.2$ get_sim_status -resubmit /vol/mg-rast-prod/jobs/3464 Qsub: Your job-array 1756778.6727-6727:1 ("ms_3464") has been submitted Qsub: Your job-array 1756779.6735-6735:1 ("ms_3464") has been submitted Qsub: Your job-array 1756780.6783-6783:1 ("ms_3464") has been submitted Qsub: Your job-array 1756781.6795-6796:1 ("ms_3464") has been submitted Qsub: Your job-array 1756782.6803-6803:1 ("ms_3464") has been submitted Qsub: Your job-array 1756783.6807-6808:1 ("ms_3464") has been submitted Qsub: Your job-array 1756784.19-19:1 ("mgg_3464") has been submitted Qsub: Your job-array 1756785.28-31:1 ("mgg_3464") has been submitted Qsub: Your job-array 1756786.44-44:1 ("mgg_3464") has been submitted Qsub: Your job-array 1756787.46-46:1 ("mgg_3464") has been submitted

1 0

Error while attempting the access of the Annotation Progress
by Bruno Donzelli 26 May '09

26 May '09

I am currently trying to access the Annotation Progress of a job (3499) using the "view details" link. This opens a page with the following message: An error has occured: (notice the misspelling) Sorry, but you are lacking the rights required for this page. To continue please go back to the start page. I am logged in, the job was submitted 5 h ago and it is my first attempt of using MG-RAST. Thanks for your help -- Bruno Donzelli Molecular Biologist USDA-ARS Robert W. Holley Center for Agriculture and Health (formerly: US Plant, Soil & Nutrition Lab) Tower Road Ithaca, NY 14853 Phone (office): (607) 255 2179 Phone (lab): (607) 255 0271 Fax: (607) 255 1132

1 0

Re: [mg-rast] SEED organism directory creation
by Jared Wilkening 25 May '09

25 May '09

It's done. 1.5T free. Jared On Mon, May 25, 2009 at 10:27 AM, Jared Wilkening <jared.wilkening(a)gmail.com > wrote: > A file clean up is in progress. There should be enough disk space to > restart things in a few hours. > > Jared > > > On Mon, May 25, 2009 at 8:42 AM, Alex Rodriguez <arodri7(a)mcs.anl.gov>wrote: > >> Hi, >> I see that the jobs that failed (3474, 3471, 3464) are large, and for one >> of them I see an error No space left on device. Jared, could you check how >> much space we have. How can we fix this? >> >> Error log: >> Wrote the sequences to the contigs file. You will probably have to reload >> everything for it all to work, eh? >> sort: write failed: standard output: No space left on device >> sort: write error >> Undefined subroutine &main::fatal called at >> /vol/mg-rast-prod/FIGdisk/FIG/bin/expand_sims line 264. >> /vol/mg-rast-prod/FIGdisk/FIG/bin/mg_create_seed_org: Failed with $!= >> $?=7168: /vol/mg-rast-prod/FIGdisk/FIG/bin/expand_sims -orgdir >> /vol/mg-rast-prod/jobs/3471/rp/4443522.3 >> /vol/mg-rast-test/Data/db/seed/018c/peg.synonyms >> /vol/mg-rast-prod/jobs/3471/rp/4443522.3/similarities >> /vol/mg-rast-prod/jobs/3471/rp/4443522.3/expanded_similarities at >> /vol/mg-rast-prod/FIGdisk/FIG/bin/mg_create_seed_org line 348 >> >> Alex >> >> On May 25, 2009, at 8:11 AM, Folker Meyer wrote: >> >> Hi, >> sorry for the problems you are experiencing. >> >> We will take a look at this and get back to you. >> >> Best, >> Folker >> >> On Mon, May 25, 2009 at 2:15 AM, Gerhard Thallinger < >> Gerhard.Thallinger(a)tugraz.at> wrote: >> >>> To whom it may concern, >>> >>> I uploaded four metagenomic sequence files to the MG-RAST server >>> last Wednesday (jobs 3474, 3475, 3476 and 3477 with IDs 4443525.3, >>> 4443527.3, 4443526.3, and 4443528.3 resp.) >>> The first job (3474) stopped with the error "SEED organism directory >>> creation has returned an error." and stalled obviously the other >>> ones. >>> >>> Any help is highly appreciated. >>> >>> Regards >>> >>> Gerhard Thallinger >>> >>> ------------------------------------------------------------------------ >>> Dr. Gerhard Thallinger E-mail: Gerhard.Thallinger(a)tugraz.at >>> Institute for Genomics and Bioinformatics Web: http://genome.tugraz.at >>> Graz University of Technology Tel: +43 316 873 5343 >>> Petersgasse 14/V Fax: +43 316 873 105343 >>> 8010 Graz, Austria Map: http://genome.tugraz.at/Loc.html >>> >>> >> >> >> -- >> -- >> Folker Meyer mailto:[email protected] >> >> >> >

1 0