March 2009 - Mg-rast - mailman3.cels.anl.gov

Your MG-RAST jobs (3052, 3056, 3057, 3060, 3061)
by Mark D'Souza 31 Mar '09

31 Mar '09

Hi, The jobs you submitted to MG-RAST have failed due to a non-IUPAC character in the DNA sequence. 3052: >contig03600 : bad char P 3056: >contig03600 : bad char P 3057: >contig03600 : bad char P 3060: >contig03600 : bad char P 3061: >contig03600 : bad char P Please edit your files to fix this and resubmit. Thanks, Mark D'Souza -- for the MG-RAST team mg-rast(a)mcs.anl.gov http://metagenomics.nmpdr.org/

1 0

MG-RAST problems
by Rachel Poretsky 31 Mar '09

31 Mar '09

Hi, I've been encountering two problems when using MG-RAST recently: 1. The Blast tool doesn't seem to work. Anytime I try to blast either a nucleotide or amino acid sequence, I get an error message that says "An error occurred while trying to blast against the [whichever metagenome I am checking]" 2. When using the KEGG map tool, I am unable to get a list of the sequences that are attributed to a particular enzyme in a pathway. The show up when I mouse over the EC number, but vanish when I click on it. Instead a get to a blank table (with headings only) and an option to export table (which does nothing). Thanks for looking into this! Rachel -- Rachel Poretsky Postdoctoral Scholar Caltech- Geological and Planetary Sciences MC 100-23 Pasadena, CA 91125 626-395-2536 (office) 626-395-6018 (lab) -- Rachel Poretsky Postdoctoral Scholar Caltech- Geological and Planetary Sciences MC 100-23 Pasadena, CA 91125 626-395-2536 (office) 626-395-6018 (lab)

1 0

Your MG-RAST job 3051
by Mark D'Souza 31 Mar '09

31 Mar '09

Hi, Your MG-RAST job 3051, Leticia failed as one of the sequences contained an '_' character which is not accepted by the system. Since it was at the end of the sequence, I deleted the character, making the sequence: >Query=_ESTOMAGO_M19R_ANIMAL_SILVESTRE CGACTTCACCCCTATCATCTGTCCCACCTTTCTGCGG and restarted the job. Regards, Mark D'Souza -- for the MG-RAST team mg-rast(a)mcs.anl.gov http://metagenomics.nmpdr.org/

1 0

Re: [mg-rast] [Barracuda SPAM] Re: removing a project
by Mark D'Souza 31 Mar '09

31 Mar '09

Hi Alberto, The sequence file had an blank line at the top and did not conform to the fasta standard which is why the system did not process it. I removed this line -- the first and last sequences are now: >000505_3174_3144 length=260 uaccno=E93TWPS13H0Z4A GCCGATTGTCTCAAACTTCACACAACATAGAAAAGTTATATTTTATGCTGTGTCTGAAATAGAGGTCTCAATTTGGTCTGTATCAGTTCTCGTATCCGTG .... >024480_2673_3788 length=56 uaccno=FJ4075211GS07I CTATTATTTTCAGGGATCTAANTTTAGACCTGGAGCTACTTCGTAGTGTAATTCAA Please verify that this matches your sequence file and that nothing got lost during upload. The job should restart in a few minutes. Regards, Mark On Tue, 31 Mar 2009, Alberto Lopez Bueno wrote: > Hi Mark, > My job number 3050 is indicated with a red colour (failed with an error). Is > the annotation progress blocked? > > Regards, > Alberto Lï¿½pez Bueno, PhD. > > > > Mark D'Souza escribiï¿½: >> Hi Alberto, >> >> I deleted the job. Please note that the 'Job Details' page has an option in >> the menu bar which lets you do this yourself if you need to in future. >> Thanks for letting us know about it. >> >> Regards, >> Mark D'Souza >> -- for the MG-RAST team >> >> mg-rast(a)mcs.anl.gov >> http://metagenomics.nmpdr.org/ >> >> >> On Mon, 30 Mar 2009, Alberto Lopez Bueno wrote: >> >>> Dear sirs, >>> last friday I uploaded (by error) the same metagenome twice . Could you >>> please remove the analysis of the project with ID number 4443041.3 (Job >>> 3032)? >>> >>> Regards, >>> Alberto Lï¿½pez Bueno, PhD. >>> > >

1 0

Re: [mg-rast] format contigs file
by Mark D'Souza 31 Mar '09

31 Mar '09

Rob, send me your code, I will see if I can make the permissions work for me. If the formatdb goes cleanly, are there any particular jobs you are interested in? I could do only those, and we can run the rest when we have the web page is in place and space issues resolved. We have between 50 and 60 GB of sequence data and less than 400 GB of space on the disk. Time for some house cleaning. Mark On Mon, 30 Mar 2009, Rob Edwards wrote: > Any chance someone with perms could formatdb all the contigs before then? I > even have the code to do it ... just not the write (right?) permissions :( > > Rob > > > On Mar 30, 2009, at 11:28 AM, Folker Meyer wrote: > >> this sounds like a good feature for the next version >> >> folker >> >> On Mar 30, 2009, at 11:44 AM, Rob Edwards wrote: >> >>> Can we (someone?) format the contigs file in the rp/ directory for (at >>> least) the public metagenomes? It would be great if we could tblastn >>> individual proteins against those metagenomes .... its something that a >>> lot of people want to see, and we should probably provide a web page for >>> it eventually. >>> >>> I suggest making the title of the database the same as the genome name >>> (perhaps with our id at the end) and also putting the formatdb log into >>> the directory. >>> >>> I could do it but don't have perms to write to the rp/ directory. >>> >>> Thanks >>> >>> Rob >> >

1 0

Re: [mg-rast] format contigs file
by Rob Edwards 30 Mar '09

30 Mar '09

Any chance someone with perms could formatdb all the contigs before then? I even have the code to do it ... just not the write (right?) permissions :( Rob On Mar 30, 2009, at 11:28 AM, Folker Meyer wrote: > this sounds like a good feature for the next version > > folker > > On Mar 30, 2009, at 11:44 AM, Rob Edwards wrote: > >> Can we (someone?) format the contigs file in the rp/ directory for >> (at least) the public metagenomes? It would be great if we could >> tblastn individual proteins against those metagenomes .... its >> something that a lot of people want to see, and we should probably >> provide a web page for it eventually. >> >> I suggest making the title of the database the same as the genome >> name (perhaps with our id at the end) and also putting the formatdb >> log into the directory. >> >> I could do it but don't have perms to write to the rp/ directory. >> >> Thanks >> >> Rob >

1 0

Re: [mg-rast] mg-rast valid users
by Folker Meyer 30 Mar '09

30 Mar '09

Ok. Then I'd say lets do that. best, Folker On Mar 30, 2009, at 3:04 PM, Rob Edwards wrote: > That would be fine - a token that lives. Its how the google api and > many others allow user access. > > We need to have programmatic access to the MG-RAST - and the web > services are working great except for the user validation part. I > just met with some students from Mexico that want to access our data > programmatically, and this just makes sense as the right thing to do. > > Rob > > > > > On Mar 30, 2009, at 11:30 AM, Folker Meyer wrote: > >> Hi Rob, >> >> sounds like you are objecting to the idea of having the token >> timeout? >> >> I think having the PW in source code is not a really good idea, how >> about a compromise, a token that does not expire? >> >> this way, users can opt in by creating a token (and or deleting >> it). Token wouldn't expire, but users can delete it for their >> account if they want? >> >> >> FOlker >> On Mar 28, 2009, at 8:58 PM, Rob Edwards wrote: >> >>> I think this is a complete programmatic nightmare and against the >>> entire spirit of web services. We want people (in fact we have >>> people) writing code to access data in mg-rast. It simply will not >>> work if they have to stop each time and go get a token. The code >>> needs to work each time, and there will almost certainly not be a >>> human to point to a web site. >>> >>> Why can't we just pass the password via SOAP? Is it any less >>> secure than our (non-https) approach we use now? >>> >>> Rob >>> >>> On Mar 27, 2009, at 10:03 AM, Folker Meyer wrote: >>> >>>> Hi Rob: >>>> >>>> can we use tokens with a one week timeout instead of passwords? >>>> >>>> I think that would make me sleep easier. I also think that we >>>> should require user to explicitly activate WS support. >>>> >>>> They could do that by creating a token. If they don't update the >>>> token WS access will expire after one week. >>>> >>>> We could either use proper public/private-key stuff or create a >>>> light-weight security a simple token like: $token= >>>> md5( drand48() + "username" + ctime() ) >>>> >>>> The access function could check on the file date for the token, >>>> if it is older than 7*24hrs, it should return an error msg >>>> pointing the user to the web page for token renewal. >>>> >>>> What do you think? >>>> >>>> Best, >>>> Folker >>>> >>>> >>>> On Mar 27, 2009, at 9:25 AM, Rob Edwards wrote: >>>> >>>>> For the web services (and probably else where), I would like a >>>>> piece of code that takes a username, a password, and an mg-rast >>>>> job (number, directory, or object ?) and just returns true if >>>>> that user has the ability to see that job. >>>>> >>>>> Is it hard to construct a subroutine that does that? >>>>> >>>>> Thanks! >>>>> >>>>> Rob >>>> >>> >> >

1 0

Re: [mg-rast] mg-rast valid users
by Rob Edwards 30 Mar '09

30 Mar '09

That would be fine - a token that lives. Its how the google api and many others allow user access. We need to have programmatic access to the MG-RAST - and the web services are working great except for the user validation part. I just met with some students from Mexico that want to access our data programmatically, and this just makes sense as the right thing to do. Rob On Mar 30, 2009, at 11:30 AM, Folker Meyer wrote: > Hi Rob, > > sounds like you are objecting to the idea of having the token timeout? > > I think having the PW in source code is not a really good idea, how > about a compromise, a token that does not expire? > > this way, users can opt in by creating a token (and or deleting it). > Token wouldn't expire, but users can delete it for their account if > they want? > > > FOlker > On Mar 28, 2009, at 8:58 PM, Rob Edwards wrote: > >> I think this is a complete programmatic nightmare and against the >> entire spirit of web services. We want people (in fact we have >> people) writing code to access data in mg-rast. It simply will not >> work if they have to stop each time and go get a token. The code >> needs to work each time, and there will almost certainly not be a >> human to point to a web site. >> >> Why can't we just pass the password via SOAP? Is it any less secure >> than our (non-https) approach we use now? >> >> Rob >> >> On Mar 27, 2009, at 10:03 AM, Folker Meyer wrote: >> >>> Hi Rob: >>> >>> can we use tokens with a one week timeout instead of passwords? >>> >>> I think that would make me sleep easier. I also think that we >>> should require user to explicitly activate WS support. >>> >>> They could do that by creating a token. If they don't update the >>> token WS access will expire after one week. >>> >>> We could either use proper public/private-key stuff or create a >>> light-weight security a simple token like: $token= md5( drand48() >>> + "username" + ctime() ) >>> >>> The access function could check on the file date for the token, if >>> it is older than 7*24hrs, it should return an error msg pointing >>> the user to the web page for token renewal. >>> >>> What do you think? >>> >>> Best, >>> Folker >>> >>> >>> On Mar 27, 2009, at 9:25 AM, Rob Edwards wrote: >>> >>>> For the web services (and probably else where), I would like a >>>> piece of code that takes a username, a password, and an mg-rast >>>> job (number, directory, or object ?) and just returns true if >>>> that user has the ability to see that job. >>>> >>>> Is it hard to construct a subroutine that does that? >>>> >>>> Thanks! >>>> >>>> Rob >>> >> >

1 0

deleting a job
by Mark D'Souza 30 Mar '09

30 Mar '09

Hi, Creating a DELETE file in the job directory does not result in the sge jobs getting qdel'd, could this be added? Does anyone know if the web browser interface 'delete' takes care of cleaning up sge jobs? Mark

1 0

Re: [mg-rast] removing a project
by Mark D'Souza 30 Mar '09

30 Mar '09

Hi Alberto, I deleted the job. Please note that the 'Job Details' page has an option in the menu bar which lets you do this yourself if you need to in future. Thanks for letting us know about it. Regards, Mark D'Souza -- for the MG-RAST team mg-rast(a)mcs.anl.gov http://metagenomics.nmpdr.org/ On Mon, 30 Mar 2009, Alberto Lopez Bueno wrote: > Dear sirs, > last friday I uploaded (by error) the same metagenome twice . Could you > please remove the analysis of the project with ID number 4443041.3 (Job > 3032)? > > Regards, > Alberto Lï¿½pez Bueno, PhD. >

1 0