August 2009 - Mg-rast - mailman3.cels.anl.gov

Re: [mg-rast] [rast] P-RAST and MG-RAST
by Gordon D. Pusch 31 Aug '09

31 Aug '09

We are sorry that your jobs had problems. Your P-RAST job 1973 appears to have failed silently, without setting the ERROR flag or sending an error e-mail. We are investigating the cause of the error, and why your job is displaying a "Completed" rather than an "Error" status. Regarding your MG-RAST jobs, please contact the MG_RAST developers at <mg-rast(a)mcs.anl.gov>. Again, we are sorry that your jobs had problems. Sincerely, -- Dr. Gordon D. Pusch RAST development Team On 2009-Aug-31, at 5:06 PM, Torsten Thomas wrote: > Hi. > > My current job (1973) in P-RAST has a current stage assigned as > "completed", but has no export data available. The job is been > sitting like this for 4 days, Along the same line, in MG-Rast my > jobs 4532 and 4524 also appear to been stuck as other jobs I > submitted at the same time have been completed for several days. > > Could you please check on this. > > Thanks a lot, > > Torsten > > Dr. Torsten Thomas > Senior Research Fellow > Centre for Marine Bio-Innovation > School of Biotechnology and Biomolecular Sciences > The University of New South Wales > Sydney, NSW 2052 > Australia > Ph + 61 (0) 2 938 53467 > Mob +61 (0) 410159525 > Fax + 61 (0) 2 938 51779 > > "Anyone who believes exponential growth can go on forever in a > finite world is either a madman or an economist" (Kenneth Boulding, > economist) > > >

1 0

Re: [mg-rast] dataset 4444130.3
by Mark D'Souza 31 Aug '09

31 Aug '09

Hi Scot, We do not have any additional information about the dataset other than what is already available at the MGRAST site. I forwarded your email to the user who submitted it so he can get in touch with you directly if he wishes. Regards, Mark D'Souza -- for the MG-RAST team mg-rast(a)mcs.anl.gov http://metagenomics.nmpdr.org/ ----- "Scot E Dowd PhD" <sdowd(a)pathogenresearch.org> wrote: > From: "Scot E Dowd PhD" <sdowd(a)pathogenresearch.org> > To: mg-rast(a)mcs.anl.gov > Sent: Monday, August 31, 2009 3:22:42 PM GMT -06:00 US/Canada Central > Subject: [mg-rast] dataset 4444130.3 > > Hi guys, > > > > I am planning to use some comparison for some of my metagenomes to > dataset 4444130.3 I am trying to find a reference for it (e.g. who > submitted it or any publication etc). Any leads you can provide to > help me track down who to credit with that data. (an email or > anything). > > > > Much appreciation, > > Scot > > > > Scot E Dowd PhD > > Director > > Research and Testing Laboratory > > Director > > Pathogenius Diagnostics > > Director > > Medical Biofilm Research Institute > > > > > > 4321 Marsha Sharp Fwy > > Lubbock, TX 79407 > > 806-789-6879 > > sdowd(a)pathogenresearch.org

1 0

Fwd: dataset 4444130.3
by dsouza＠mcs.anl.gov 31 Aug '09

31 Aug '09

Hi, I am forwarding an email we received from an MGRAST user who is using a metagenome dataset of yours which you had made public so that you can get in contact with him if you like. Regards, Mark D'Souza -- for the MG-RAST team mg-rast(a)mcs.anl.gov http://metagenomics.nmpdr.org/ ----- "Scot E Dowd PhD" <sdowd(a)pathogenresearch.org> wrote: > From: "Scot E Dowd PhD" <sdowd(a)pathogenresearch.org> > To: mg-rast(a)mcs.anl.gov > Sent: Monday, August 31, 2009 3:22:42 PM GMT -06:00 US/Canada Central > Subject: [mg-rast] dataset 4444130.3 > > Hi guys, > > > > I am planning to use some comparison for some of my metagenomes to > dataset 4444130.3 I am trying to find a reference for it (e.g. who > submitted it or any publication etc). Any leads you can provide to > help me track down who to credit with that data. (an email or > anything). > > > > Much appreciation, > > Scot > > > > Scot E Dowd PhD > > Director > > Research and Testing Laboratory > > Director > > Pathogenius Diagnostics > > Director > > Medical Biofilm Research Institute > > > > > > 4321 Marsha Sharp Fwy > > Lubbock, TX 79407 > > 806-789-6879 > > sdowd(a)pathogenresearch.org

1 0

dataset 4444130.3
by Scot E Dowd PhD 31 Aug '09

31 Aug '09

Hi guys, I am planning to use some comparison for some of my metagenomes to dataset 4444130.3 I am trying to find a reference for it (e.g. who submitted it or any publication etc). Any leads you can provide to help me track down who to credit with that data. (an email or anything). Much appreciation, Scot Scot E Dowd PhD Director Research and Testing Laboratory Director Pathogenius Diagnostics Director Medical Biofilm Research Institute 4321 Marsha Sharp Fwy Lubbock, TX 79407 806-789-6879 sdowd(a)pathogenresearch.org

1 0

MG-RAST job submission
by Tesfaye Wubet 31 Aug '09

31 Aug '09

Dear Mark, I just tried larger data set submission to the MG RAST database but it failed . Since the .fna files are larger between 160-172 MB, I compressed them using gzip with the suffix .tgz as recommended on the submission page of the website.The compressed files are 50 and 54 MB respectively. It gave me an error message of: error unpacking uploaded tarfile: *Error closing tar pipe line:$?=512 $!=at/vol/mg-rast-prod/Frontend-FIGdisk/dist/releases/dev/common/lib/MGRAST/WebPage/uploadMetagenome.pm line 680. *could you please give me your advises or other options? looking forward, Regards Tesfaye Tesfaye Wubet wrote: > Dear Mark, > > I just tried larger data set submission to the MG RAST database but it > failed . Since the .fna files are larger between 160-172 MB, I > compressed them using gzip with the suffix .tgz as recommended on the > submission page of the website.The compressed files are 50 and 54 MB > respectively. It gave me an error message of: error unpacking uploaded > tarfile: *Error closing tar pipe line:$?=512 > $!=at/vol/mg-rast-prod/Frontend-FIGdisk/dist/releases/dev/common/lib/MGRAST/WebPage/uploadMetagenome.pm > line 680. > > *could you please give me your advises or other options? > > looking forward, > > Regards > > Tesfaye > > Tesfaye Wubet wrote: >> Dear Mark, >> >> Thanks a lot for the trouble shooting. I will submit the second set >> now. Looking forward to see the complete annotation of the sequences. >> cheers >> tesfaye >> >> dsouza(a)mcs.anl.gov wrote: >>> Hi, >>> >>> The job you submitted to MG-RAST (2845, HEG_meta_0762000_0762500) >>> has failed as the sequence file does not conform to the fasta >>> standard since the last sequence ended in a '}' character as below. >>> >>> >>>> FYXQQTA01A9P6H rank=0762497 x=403.0 y=2871.5 length=449 >>>> >>> ATCACCGAGGCGGCGACGAGGATCAGCACGAAGATGATGGACGCCCAGAGGGCGCGGTTG >>> CGCCTCACGCCAGCTCTGCTCCGTTGATCACCAGACGGAAGCGCGCATCGAGCAGCTCGG >>> CGGCGTGCCGGCAGAGCTGCATGCGTCCAAGGAAGATCTCGAAGTACTCCATGACCTGAC >>> TGATCCCGGTGTCGATCGTCAGCTCGAGGCTGACGGTGCGGGCCTCCGAGTCTACCGACA >>> GGAACGAAGTTCGACGGCATGGTTCACGCGATCGTGAACGTCGAGCTCGATCCTGCCGGA >>> CCTGCGCACCCGGCTCCGATGCACGTCGGACTTGTCGGCGAGGATCACCGCGGCGGAGAT >>> CGGGCTGACGGCGACGCCTTCGGTCTCCTCGTGGTTCGCGATCGCCGCGAGGATCGGCAT >>> CAGGTCCGCGCCGTGCACCGAGTCGCGGA} >>> >>> I deleted this single character and restarted the job, it should >>> proceed normally. Please check that your sequence file did not get >>> corrupted during the upload and resubmit to MG-RAST if necessary. >>> >>> Regards, >>> Mark D'Souza >>> -- for the MG-RAST team >>> >>> mg-rast(a)mcs.anl.gov >>> http://metagenomics.nmpdr.org/ >>> >> >> > > -- Dr. Tesfaye Wubet Department of Soil Ecology Helmholtz Centre for Environmental Research - UFZ Theodor-Lieser-Straße 4 06120 Halle-Saale/ Germany Phone +49 345 558 5204 Fax +49 345 558 5449 e-mail tesfaye.wubet(a)ufz.de Web http://www.ufz.de Helmholtz Centre for Environmental Research - UFZ Registered Office: Leipzig Registration Office: Amtsgericht Leipzig Trade Register Nr. B 4703 Chairman of the Supervisory Board: MinDirig Hartmut F. Grübel Scientific Director: Prof. Dr. Georg Teutsch Administrative Director: Dr. Andreas Schmidt

1 0

Naviaux Lab Attempted File Upload Failure
by Robert K. Naviaux 28 Aug '09

28 Aug '09

Hi, I tried to upload the attached file of 4988 sequences from our metagenome of Pacific Beach. On my "Jobs Overview" page, it says, "You currently have no jobs." Was the system able to upload and process my file? Thanks, Bob Robert K. Naviaux, MD, PhD Departments of Medicine, Pediatrics, and Pathology President, Mitochondrial Medicine Society Professor and Co-director The Mitochondrial and Metabolic Disease Center Biochemical Genetics and Metabolism UCSD School of Medicine 214 Dickinson St., Room C-102 San Diego, CA 92103-8467 tel: (619) 543-2904 fax: (619) 543-7868 email: naviaux(a)ucsd.edu MMDC Website: biochemgen.ucsd.edu Mitochondrial Medicine Society Website: www.mitosoc.org CONFIDENTIALITY NOTICE: This email message and any attachments are for the sole use of the intended recipient(s) and may contain confidential, proprietary, and privileged information protected by law. Any unauthorized review, use, disclosure, reproduction, or distribution is strictly prohibited. If you are not the intended recipient, please contact the sender by reply email and delete and destroy all electronic and physical copies of the original message. Thank you.

1 0

Re: [mg-rast] MG-RAST downtime
by Jared Wilkening 26 Aug '09

26 Aug '09

MG-RAST site is now down. Current message: "MG-RAST is currently undergoing maintenance and will be unavailable for the next few hours. We apologize for any inconvenience this may cause." On Tue, Aug 25, 2009 at 5:25 PM, Jared Wilkening <jared(a)mcs.anl.gov> wrote: > Tomorrow 8/26 MG-RAST will be down for maintenance for at least a few hours > while the DB server switches racks. I disabled the pipeline and put up a > notice to the users. Tomorrow I will disable the webapp right before we > begin the move. > > Cheers, > Jared > > Current message: > "In preparation for maintenance occurring on 8/25 the processing pipeline > has been disabled. Browsing private and public data is still possible during > this time. Note new uploads will not be visible until the processing > pipeline is enabled. We apologize in advance for any inconvenience." > > Tomorrows maintenance message: > "MG-RAST is currently undergoing maintenance and will be unavailable for > the next few hours. We for any inconvenience this may cause."

1 0

Re: [mg-rast] job 4478
by Andreas Wilke 26 Aug '09

26 Aug '09

Dear Nadja Larsen, the file you have uploaded contains 17080 sequences (job 4478). The preprocessing step is removing duplicate sequences, in your case your file contains only only 4275 unique sequences. Regards, Andreas On Aug 26, 2009, at 9:14 AM, Nadja Larsen wrote: > Dear Sir, > > Please explain why I can only get approx 4,000 sequences from 18,000 > sequences (bacteria) downloaded in fasta. Job detailes attached. > I've got the same for the other two downloads (jobs 4479, 4490). > > Sincerely, Nadja Larsen > > University of Copenhagen > Faculty of Life Science, Department of Food Science > Rolighedsvej 30, 1958 Frederiksberg > tel.: (+45) 35333235 > e-mail: nf(a)life.ku.dk > > > <Job4478.doc> ------------------------------------------------------ Andreas Wilke Argonne National Laboratory Mathematics and Computer Science Division Bldg. 221, Room A147 9700 South Cass Avenue Argonne, IL 60439 (630) 252-3190 (phone) (630) 252-5986.(fax) -------------------------------------------------------

1 0

Re: [mg-rast] job 4478
by Folker Meyer 26 Aug '09

26 Aug '09

Nadja, we are doing some hardware work today and MG-RAST will likely be down for part or most of the day. if the screen shot contains vital information, can you please re-send in a non windows format. We do not use windows systems. The likely explanation is that 14k of your sequences did not match the known proteins in our nr (non redundant database). We will however investigate. Best, Folker On Aug 26, 2009, at 9:14 AM, Nadja Larsen wrote: > Dear Sir, > > Please explain why I can only get approx 4,000 sequences from 18,000 > sequences (bacteria) downloaded in fasta. Job detailes attached. > I've got the same for the other two downloads (jobs 4479, 4490). > > Sincerely, Nadja Larsen > > University of Copenhagen > Faculty of Life Science, Department of Food Science > Rolighedsvej 30, 1958 Frederiksberg > tel.: (+45) 35333235 > e-mail: nf(a)life.ku.dk > > > <Job4478.doc>

1 0

job 4478
by Nadja Larsen 26 Aug '09

26 Aug '09

Dear Sir, Please explain why I can only get approx 4,000 sequences from 18,000 sequences (bacteria) downloaded in fasta. Job detailes attached. I've got the same for the other two downloads (jobs 4479, 4490). Sincerely, Nadja Larsen University of Copenhagen Faculty of Life Science, Department of Food Science Rolighedsvej 30, 1958 Frederiksberg tel.: (+45) 35333235 e-mail: nf(a)life.ku.dk

1 0