April 2011 - Mg-rast - mailman3.cels.anl.gov

Incorrect sequences/e-values returned from Workbench
by David Bernick 29 Apr '11

29 Apr '11

Greetings - I am investigating the specific sequences that were found to be from metagenome A23-63 (4461888.3). I used the org. classification page, using M5NR at an e-value of 10-5. In the barchart view, I selected the Nanoarchaeota sequences at the class distribution level - clicked "to workbench" and it reported 2 unique proteins that had been moved to the workbench. The following 4 sequences were returned , and none of these map to Nanoarchaea. I used blastx (NR, blosum45, blastp, wordsize 2) and find instead that they map to: Halobacterium - deoxycytidine triphosphate deaminase (e-value 8e-5) sequence 1 Halobacterium - deoxycytidine triphosphate deaminase (e-value 2e-18) sequence 2 Nanoarchaeum equitans - replication factor c (e-value 2 e-3) sequence 3 Nanoarchaeum equitans - replication factor c (e-value 0.21) sequence 4 As you can see, the first 2 hits look promising, but are not Nano eq. The second 2 hits are low e-value hits, greater than the 10^-5 cutoff. can you help with this?? all the best - David Bernick ps. this is a wonderful tool !!! >4461888.3|2711025 CCAGCATCGCTCGATGTTCGACTCGGAAACGAGTTCTTCGACGCCGAGACGGGCAAGCGA TGGGAGAGCGACGGCCTCCGTCTCGAACCCGGTGAGCGGTACTTAACTCATACAAAAGAG ACAGTAGAACTATCCCGAAATATTGCAGCGCAACTAACCGGACGTTCGAGTATCGGGAGA CAAGGTATAATCGTCCATATGACGGCTGGATGGATC >4461888.3|2929791 TTCCCGAGATTCATCATTTCAAGGACTATCTCACCACGGAAGCCGGGGTCGATCCACCCG GCGGTCTTGTGAACGATGATGCCTTGCCGTCCGATACTGGACCGCCCAGTAAGCTGTGCA GCGAAGTTGCGAGACAGCTCTATCGTTTCTTTCGTATGAGCTAAGTACCGTTCACCGGGT TCGAGACGAAGGCCGTCACTCTCCCATCGCTTGCCTGTTTCGGCATCGAAGAACTCGTCA CCAAGTCGAACATCGAGTGATGCGGGTTGGAGTTGGGAATCCATATCAACCGGATCGACG GCAATCTCACCATCCCACATTTTGTCATAGATGCTTTGATCTGAGAGTATCATCAGGATT TAATCTCAACAGAGTCTCGGTCAAAGTGCTGGAATTTGTGGCTATCAAGCGGAGCCTCTA CCATCTCGGCGCTACCACCAGCCGCTTCGTATGTCGTCGCTTCACTCTCGGAGTAGAAGT CAGTTCCATTCAT >4461888.3|2056525 CAGGGTACGATTGGCGACCATCAGTACAAAATCGTATTCCTTGATGAGGCTGACCAGCTC ACGAAAGATGCTCAAACTGCACTCCGGCGTATCATGGAGGAC >4461888.3|2061435 GTTTGAGCATCTTTCGTGAGCTGGTCAGCCTCATCAAGAAATACGATTTTGTACTGATGG TCGCCAATCGTACCCTGAACAGCGTAGTTCTTCACCTTATCT

1 0

Re: [mg-rast] Jobs#7615,7647,7650
by Mark D'Souza 29 Apr '11

29 Apr '11

Hi, Your jobs have all completed processing now. Regards, Mark On Apr 27, 2011, at 12:16 PM, Rebecca Reiss wrote: > Mark > > Thanks for getting back to me so quickly! > > Rebecca > > On Apr 26, 2011, at 3:56 PM, Mark D'Souza wrote: > >> Hi, >> >> Sorry about the delay, the three jobs were not processed cleanly when they were run in version 3. They were restarted yesterday and are queued for similarity computation, they should complete in a couple of days. >> >> Regards, >> Mark D'Souza >> -- for the MG-RAST team >> >> mg-rast(a)mcs.anl.gov >> http://metagenomics.anl.gov/ >> >> If you need to respond to this email please address it to the mailing-list mg-rast(a)mcs.anl.gov >> >> >> >> >> On Apr 26, 2011, at 3:14 PM, Rebecca Reiss wrote: >> >>> Greetings >>> >>> I am in the process of working on a manuscript for a metagenomics that involves four datasets. EW3Pre1, EW3Post1, EW3Pre2, and EW3Post2. EW3Post2 has been ported to the new version, but the other three (Jobs 7615, 7647, 7650) are still in progress. >>> >>> I am impressed with the new version and I would prefer to publish the results from MGRast 3. Can you estimate when the other three datasets will be available? By the way, The data are paired-end illumina data with 90 bp reads. >>> >>> Also, this project was originally under the name David Medcalf, but due to budget cuts, he no longer works here. I have made the appropriate changes to the account, but any previous e-mails regarding the new version were not received. >>> >>> And finally, as soon as a manuscript is accepted, I will be happy to make these datasets available for public use. >>> >>> >>> Rebecca Reiss, Ph.D. >>> Associate Professor, Biology >>> Jones Annex 313 >>> New Mexico Tech >>> Socorro, New Mexico 87801 >>> (575) 835-5347 >>> FAX (575) 835-5668 >>> > > Rebecca Reiss, Ph.D. > Associate Professor, Biology > Jones Annex 313 > New Mexico Tech > Socorro, New Mexico 87801 > (575) 835-5347 > FAX (575) 835-5668 >

1 0

Re: [mg-rast] sharing metagenomes
by Mark D'Souza 29 Apr '11

29 Apr '11

Hi Liz, I think the best way to do this will be to transfer ownership of their jobs to you and then you will be able to share access with other users. Please take a look at the attached list of jobs submitted by Bahador and Matt Doherty and let us know which ones should belong to you. Regards, Mark On Apr 28, 2011, at 2:34 PM, liz dinsdale wrote: > HI Mark > > I need the ability to share jobs up loaded by my students with other people > > two examples of this are file up loaded by Bahador and Matt Doherty - neither of which work for me any more. I have access to the files but i need to give access to a third person, which i am unable > > thanks > > Liz > > Elizabeth Dinsdale, PhD > Assistant Professor > Biology Department > San Diego State University > 5500 Campanile Dr > San Diego 92182 > California > > > > > > Date: Thu, 28 Apr 2011 14:30:58 -0500 > > From: dsouza(a)mcs.anl.gov > > To: elizabeth_dinsdale(a)hotmail.com > > CC: mg-rast(a)mcs.anl.gov > > Subject: Re: [mg-rast] sharing metagenomes > > > > Hi, > > > > Sorry about that, my mail client put a previous email from you with the same subject and a similar request mentioning steven.quistad(a)gmail.com into this thread. > > > > Do I understand that you would like all jobs belonging to Bahador to be shared with Matt Doherty and you. > > > > Mark > > > > ----- Original Message ----- > > > From: "Mark D'Souza" <dsouza(a)mcs.anl.gov> > > > To: "liz dinsdale" <elizabeth_dinsdale(a)hotmail.com> > > > Cc: mg-rast(a)mcs.anl.gov > > > Sent: Thursday, April 28, 2011 2:23:58 PM > > > Subject: Re: [mg-rast] sharing metagenomes > > > Hi Liz, > > > > > > Could you clarify, do you want 444511.3 or # 4435 > > > MillSharkLIMic20090422 to be shared with steven.quistad(a)gmail.com, > > > Matt Doherty or both? > > > > > > Thanks, > > > Mark > > > > > > > > > > > > On Apr 27, 2011, at 3:32 PM, liz dinsdale wrote: > > > > > > > Great thanks > > > > > > > > the student is Matt Doherty > > > > > > > > Liz > > > > Elizabeth Dinsdale, PhD > > > > Assistant Professor > > > > Biology Department > > > > San Diego State University > > > > 5500 Campanile Dr > > > > San Diego 92182 > > > > California > > > > > > > > > > > > > > > > > > > > > Subject: Re: [mg-rast] sharing metagenomes > > > > > From: dsouza(a)mcs.anl.gov > > > > > Date: Wed, 27 Apr 2011 15:28:31 -0500 > > > > > CC: mg-rast(a)mcs.anl.gov > > > > > To: elizabeth_dinsdale(a)hotmail.com > > > > > > > > > > Hi, > > > > > > > > > > It is possible, but there are some things I need to check, I will > > > > > get back to you. > > > > > > > > > > Regards, > > > > > Mark D'Souza > > > > > -- for the MG-RAST team > > > > > > > > > > mg-rast(a)mcs.anl.gov > > > > > http://metagenomics.anl.gov/ > > > > > > > > > > If you need to respond to this email please address it to the > > > > > mailing-list mg-rast(a)mcs.anl.gov > > > > > > > > > > > > > > > > > > > > > > > > > On Oct 29, 2010, at 5:31 PM, liz dinsdale wrote: > > > > > > > > > > > Hi > > > > > > > > > > > > I would like to share one of my metagenomes that was up loaded > > > > > > by another person - is that possible > > > > > > > > > > > > the metagenome is #444511.3 or # 4435 MillSharkLIMic20090422 - > > > > > > up loaded by Bahador Nosrat > > > > > > > > > > > > i would like the metagenomes shared with > > > > > > steven.quistad(a)gmail.com > > > > > > > > > > > > thanks > > > > > > > > > > > > liz > > > > > > > > > > > > > > > > > > Elizabeth Dinsdale, PhD > > > > > > Assistant Professor > > > > > > Biology Department > > > > > > San Diego State University > > > > > > 5500 Campanile Dr > > > > > > San Diego 92182 > > > > > > California > > > > > > > > > > > > > > > > >

1 0

Re: [mg-rast] Info about processing
by Mark D'Souza 29 Apr '11

29 Apr '11

Dear Dr. Casaburi, The system had a problem with the processing of your file due to the presence of the space in the directory name 'celiachia .sff'. Please rename your directory to remove the space and resubmit this job to the MG-RAST system. Regards, Mark D'Souza -- for the MG-RAST team mg-rast(a)mcs.anl.gov http://metagenomics.anl.gov/ If you need to respond to this email please address it to the mailing-list mg-rast(a)mcs.anl.gov On Apr 29, 2011, at 7:54 AM, gcasaburi(a)tiscali.it wrote: > Dear MG-Rast, > > i made an upload on 2011-04-26 at 09:09:31 called > "celiachia.zip" ( md5 936afcddca4e0640163252233a9b93ab > status upload > completed, processing started ) . Can you give me any information about > the time that occure to process the file ? Is there any problem ? I > hope you will answer me soon. > Best > > Dr. Giorgio Casaburi > > > Non temiamo alcun confronto: Tiscali ha l'Adsl più veloce d'Italia! > > Risparmia con Tutto Incluso Light: Voce + Adsl 20 mega a soli 17,95 € al mese per 12 mesi. > > http://abbonati.tiscali.it/telefono-adsl/prodotti/tc/tuttoincluso_light/?WT…

1 0

Re: [mg-rast] Data analysis
by Tobias Paczian 29 Apr '11

29 Apr '11

This appears to be a sorting problem that occurs because the categories get sorted by p-value. I am on it. Cheers Tobi On Apr 28, 2011, at 10:52 AM, Mark D'Souza wrote: > Hi Tobi, > > Can you take a look into this? > > I confirmed that this bug exists, I clicked on Potassium Metabolism > and the level 2 category displayed is Photosynthesis. > > > <screen-capture-2.png> > Thanks, > Mark > > > > Begin forwarded message: > >> From: Torey Looft <tlooft(a)iastate.edu> >> Date: April 28, 2011 10:16:11 AM CDT >> To: mg-rast(a)mcs.anl.gov >> Subject: [mg-rast] Data analysis >> >> Hello, >> >> I think I have noticed a problem with the barchart section of your >> organism and functional classification analysis. When I use the p- >> value option, and I click on the categories (at each level >> distribution) the category that is expanded below isn't the one I >> clicked on. For example, if I click on nitrogen metabolism on >> level one, level two shows Clustering-based subsystem rather than >> the expanded nitrogen metabolism. I think I only noticed this with >> the p-vale option being used, but I what to use it for comparing >> groups. Thanks for your time! >> >> Best, >> Torey >

1 0

Info about processing
by gcasaburi＠tiscali.it 29 Apr '11

29 Apr '11

Dear MG-Rast, i made an upload on 2011-04-26 at 09:09:31 called "celiachia.zip" ( md5 936afcddca4e0640163252233a9b93ab status upload completed, processing started ) . Can you give me any information about the time that occure to process the file ? Is there any problem ? I hope you will answer me soon. Best Dr. Giorgio Casaburi Non temiamo alcun confronto: Tiscali ha l'Adsl più veloce d'Italia! Risparmia con Tutto Incluso Light: Voce + Adsl 20 mega a soli 17,95 € al mese per 12 mesi. http://abbonati.tiscali.it/telefono-adsl/prodotti/tc/tuttoincluso_light/?WT…

1 0

Re: [mg-rast] Fwd: sharing metagenomes
by Folker Meyer 28 Apr '11

28 Apr '11

Mark Change owner to Liz after asking existing owners. That is what PI info is for. Folker -- Sent from mobile device On Apr 28, 2011, at 3:43 PM, Mark D'Souza <dsouza(a)mcs.anl.gov> wrote: > Hmm, bit of a mess here with me combining two email threads and misunderstanding her request. > > ----- Forwarded Message ----- >> From: "liz dinsdale" <elizabeth_dinsdale(a)hotmail.com> >> To: dsouza(a)mcs.anl.gov >> Sent: Thursday, April 28, 2011 2:34:49 PM >> Subject: RE: [mg-rast] sharing metagenomes >> HI Mark >> >> I need the ability to share jobs up loaded by my students with other >> people >> >> two examples of this are file up loaded by Bahador and Matt Doherty - >> neither of which work for me any more. I have access to the files but >> i need to give access to a third person, which i am unable >> >> thanks >> >> Liz >> >> Elizabeth Dinsdale, PhD >> Assistant Professor >> Biology Department >> San Diego State University >> 5500 Campanile Dr >> San Diego 92182 >> California >> >> >> >> >>> Date: Thu, 28 Apr 2011 14:30:58 -0500 >>> From: dsouza(a)mcs.anl.gov >>> To: elizabeth_dinsdale(a)hotmail.com >>> CC: mg-rast(a)mcs.anl.gov >>> Subject: Re: [mg-rast] sharing metagenomes >>> >>> Hi, >>> >>> Sorry about that, my mail client put a previous email from you with >>> the same subject and a similar request mentioning >>> steven.quistad(a)gmail.com into this thread. >>> >>> Do I understand that you would like all jobs belonging to Bahador to >>> be shared with Matt Doherty and you. >>> >>> Mark >>> >>> ----- Original Message ----- >>>> From: "Mark D'Souza" <dsouza(a)mcs.anl.gov> >>>> To: "liz dinsdale" <elizabeth_dinsdale(a)hotmail.com> >>>> Cc: mg-rast(a)mcs.anl.gov >>>> Sent: Thursday, April 28, 2011 2:23:58 PM >>>> Subject: Re: [mg-rast] sharing metagenomes >>>> Hi Liz, >>>> >>>> Could you clarify, do you want 444511.3 or # 4435 >>>> MillSharkLIMic20090422 to be shared with steven.quistad(a)gmail.com, >>>> Matt Doherty or both? >>>> >>>> Thanks, >>>> Mark >>>> >>>> >>>> >>>> On Apr 27, 2011, at 3:32 PM, liz dinsdale wrote: >>>> >>>>> Great thanks >>>>> >>>>> the student is Matt Doherty >>>>> >>>>> Liz >>>>> Elizabeth Dinsdale, PhD >>>>> Assistant Professor >>>>> Biology Department >>>>> San Diego State University >>>>> 5500 Campanile Dr >>>>> San Diego 92182 >>>>> California >>>>> >>>>> >>>>> >>>>> >>>>>> Subject: Re: [mg-rast] sharing metagenomes >>>>>> From: dsouza(a)mcs.anl.gov >>>>>> Date: Wed, 27 Apr 2011 15:28:31 -0500 >>>>>> CC: mg-rast(a)mcs.anl.gov >>>>>> To: elizabeth_dinsdale(a)hotmail.com >>>>>> >>>>>> Hi, >>>>>> >>>>>> It is possible, but there are some things I need to check, I >>>>>> will >>>>>> get back to you. >>>>>> >>>>>> Regards, >>>>>> Mark D'Souza >>>>>> -- for the MG-RAST team >>>>>> >>>>>> mg-rast(a)mcs.anl.gov >>>>>> http://metagenomics.anl.gov/ >>>>>> >>>>>> If you need to respond to this email please address it to the >>>>>> mailing-list mg-rast(a)mcs.anl.gov >>>>>> >>>>>> >>>>>> >>>>>> >>>>>> On Oct 29, 2010, at 5:31 PM, liz dinsdale wrote: >>>>>> >>>>>>> Hi >>>>>>> >>>>>>> I would like to share one of my metagenomes that was up >>>>>>> loaded >>>>>>> by another person - is that possible >>>>>>> >>>>>>> the metagenome is #444511.3 or # 4435 MillSharkLIMic20090422 >>>>>>> - >>>>>>> up loaded by Bahador Nosrat >>>>>>> >>>>>>> i would like the metagenomes shared with >>>>>>> steven.quistad(a)gmail.com >>>>>>> >>>>>>> thanks >>>>>>> >>>>>>> liz >>>>>>> >>>>>>> >>>>>>> Elizabeth Dinsdale, PhD >>>>>>> Assistant Professor >>>>>>> Biology Department >>>>>>> San Diego State University >>>>>>> 5500 Campanile Dr >>>>>>> San Diego 92182 >>>>>>> California >>>>>>> >>>>>>> >>>>>>

1 0

Fwd: sharing metagenomes
by Mark D'Souza 28 Apr '11

28 Apr '11

Hmm, bit of a mess here with me combining two email threads and misunderstanding her request. ----- Forwarded Message ----- > From: "liz dinsdale" <elizabeth_dinsdale(a)hotmail.com> > To: dsouza(a)mcs.anl.gov > Sent: Thursday, April 28, 2011 2:34:49 PM > Subject: RE: [mg-rast] sharing metagenomes > HI Mark > > I need the ability to share jobs up loaded by my students with other > people > > two examples of this are file up loaded by Bahador and Matt Doherty - > neither of which work for me any more. I have access to the files but > i need to give access to a third person, which i am unable > > thanks > > Liz > > Elizabeth Dinsdale, PhD > Assistant Professor > Biology Department > San Diego State University > 5500 Campanile Dr > San Diego 92182 > California > > > > > > Date: Thu, 28 Apr 2011 14:30:58 -0500 > > From: dsouza(a)mcs.anl.gov > > To: elizabeth_dinsdale(a)hotmail.com > > CC: mg-rast(a)mcs.anl.gov > > Subject: Re: [mg-rast] sharing metagenomes > > > > Hi, > > > > Sorry about that, my mail client put a previous email from you with > > the same subject and a similar request mentioning > > steven.quistad(a)gmail.com into this thread. > > > > Do I understand that you would like all jobs belonging to Bahador to > > be shared with Matt Doherty and you. > > > > Mark > > > > ----- Original Message ----- > > > From: "Mark D'Souza" <dsouza(a)mcs.anl.gov> > > > To: "liz dinsdale" <elizabeth_dinsdale(a)hotmail.com> > > > Cc: mg-rast(a)mcs.anl.gov > > > Sent: Thursday, April 28, 2011 2:23:58 PM > > > Subject: Re: [mg-rast] sharing metagenomes > > > Hi Liz, > > > > > > Could you clarify, do you want 444511.3 or # 4435 > > > MillSharkLIMic20090422 to be shared with steven.quistad(a)gmail.com, > > > Matt Doherty or both? > > > > > > Thanks, > > > Mark > > > > > > > > > > > > On Apr 27, 2011, at 3:32 PM, liz dinsdale wrote: > > > > > > > Great thanks > > > > > > > > the student is Matt Doherty > > > > > > > > Liz > > > > Elizabeth Dinsdale, PhD > > > > Assistant Professor > > > > Biology Department > > > > San Diego State University > > > > 5500 Campanile Dr > > > > San Diego 92182 > > > > California > > > > > > > > > > > > > > > > > > > > > Subject: Re: [mg-rast] sharing metagenomes > > > > > From: dsouza(a)mcs.anl.gov > > > > > Date: Wed, 27 Apr 2011 15:28:31 -0500 > > > > > CC: mg-rast(a)mcs.anl.gov > > > > > To: elizabeth_dinsdale(a)hotmail.com > > > > > > > > > > Hi, > > > > > > > > > > It is possible, but there are some things I need to check, I > > > > > will > > > > > get back to you. > > > > > > > > > > Regards, > > > > > Mark D'Souza > > > > > -- for the MG-RAST team > > > > > > > > > > mg-rast(a)mcs.anl.gov > > > > > http://metagenomics.anl.gov/ > > > > > > > > > > If you need to respond to this email please address it to the > > > > > mailing-list mg-rast(a)mcs.anl.gov > > > > > > > > > > > > > > > > > > > > > > > > > On Oct 29, 2010, at 5:31 PM, liz dinsdale wrote: > > > > > > > > > > > Hi > > > > > > > > > > > > I would like to share one of my metagenomes that was up > > > > > > loaded > > > > > > by another person - is that possible > > > > > > > > > > > > the metagenome is #444511.3 or # 4435 MillSharkLIMic20090422 > > > > > > - > > > > > > up loaded by Bahador Nosrat > > > > > > > > > > > > i would like the metagenomes shared with > > > > > > steven.quistad(a)gmail.com > > > > > > > > > > > > thanks > > > > > > > > > > > > liz > > > > > > > > > > > > > > > > > > Elizabeth Dinsdale, PhD > > > > > > Assistant Professor > > > > > > Biology Department > > > > > > San Diego State University > > > > > > 5500 Campanile Dr > > > > > > San Diego 92182 > > > > > > California > > > > > > > > > > > > > > > > >

1 0

Re: [mg-rast] sharing metagenomes
by Mark D'Souza 28 Apr '11

28 Apr '11

Hi, Sorry about that, my mail client put a previous email from you with the same subject and a similar request mentioning steven.quistad(a)gmail.com into this thread. Do I understand that you would like all jobs belonging to Bahador to be shared with Matt Doherty and you. Mark ----- Original Message ----- > From: "Mark D'Souza" <dsouza(a)mcs.anl.gov> > To: "liz dinsdale" <elizabeth_dinsdale(a)hotmail.com> > Cc: mg-rast(a)mcs.anl.gov > Sent: Thursday, April 28, 2011 2:23:58 PM > Subject: Re: [mg-rast] sharing metagenomes > Hi Liz, > > Could you clarify, do you want 444511.3 or # 4435 > MillSharkLIMic20090422 to be shared with steven.quistad(a)gmail.com, > Matt Doherty or both? > > Thanks, > Mark > > > > On Apr 27, 2011, at 3:32 PM, liz dinsdale wrote: > > > Great thanks > > > > the student is Matt Doherty > > > > Liz > > Elizabeth Dinsdale, PhD > > Assistant Professor > > Biology Department > > San Diego State University > > 5500 Campanile Dr > > San Diego 92182 > > California > > > > > > > > > > > Subject: Re: [mg-rast] sharing metagenomes > > > From: dsouza(a)mcs.anl.gov > > > Date: Wed, 27 Apr 2011 15:28:31 -0500 > > > CC: mg-rast(a)mcs.anl.gov > > > To: elizabeth_dinsdale(a)hotmail.com > > > > > > Hi, > > > > > > It is possible, but there are some things I need to check, I will > > > get back to you. > > > > > > Regards, > > > Mark D'Souza > > > -- for the MG-RAST team > > > > > > mg-rast(a)mcs.anl.gov > > > http://metagenomics.anl.gov/ > > > > > > If you need to respond to this email please address it to the > > > mailing-list mg-rast(a)mcs.anl.gov > > > > > > > > > > > > > > > On Oct 29, 2010, at 5:31 PM, liz dinsdale wrote: > > > > > > > Hi > > > > > > > > I would like to share one of my metagenomes that was up loaded > > > > by another person - is that possible > > > > > > > > the metagenome is #444511.3 or # 4435 MillSharkLIMic20090422 - > > > > up loaded by Bahador Nosrat > > > > > > > > i would like the metagenomes shared with > > > > steven.quistad(a)gmail.com > > > > > > > > thanks > > > > > > > > liz > > > > > > > > > > > > Elizabeth Dinsdale, PhD > > > > Assistant Professor > > > > Biology Department > > > > San Diego State University > > > > 5500 Campanile Dr > > > > San Diego 92182 > > > > California > > > > > > > > > > >

1 0

Re: [mg-rast] sharing metagenomes
by Mark D'Souza 28 Apr '11

28 Apr '11

Hi Liz, Could you clarify, do you want 444511.3 or # 4435 MillSharkLIMic20090422 to be shared with steven.quistad(a)gmail.com, Matt Doherty or both? Thanks, Mark On Apr 27, 2011, at 3:32 PM, liz dinsdale wrote: > Great thanks > > the student is Matt Doherty > > Liz > Elizabeth Dinsdale, PhD > Assistant Professor > Biology Department > San Diego State University > 5500 Campanile Dr > San Diego 92182 > California > > > > > > Subject: Re: [mg-rast] sharing metagenomes > > From: dsouza(a)mcs.anl.gov > > Date: Wed, 27 Apr 2011 15:28:31 -0500 > > CC: mg-rast(a)mcs.anl.gov > > To: elizabeth_dinsdale(a)hotmail.com > > > > Hi, > > > > It is possible, but there are some things I need to check, I will get back to you. > > > > Regards, > > Mark D'Souza > > -- for the MG-RAST team > > > > mg-rast(a)mcs.anl.gov > > http://metagenomics.anl.gov/ > > > > If you need to respond to this email please address it to the mailing-list mg-rast(a)mcs.anl.gov > > > > > > > > > > On Oct 29, 2010, at 5:31 PM, liz dinsdale wrote: > > > > > Hi > > > > > > I would like to share one of my metagenomes that was up loaded by another person - is that possible > > > > > > the metagenome is #444511.3 or # 4435 MillSharkLIMic20090422 - up loaded by Bahador Nosrat > > > > > > i would like the metagenomes shared with steven.quistad(a)gmail.com > > > > > > thanks > > > > > > liz > > > > > > > > > Elizabeth Dinsdale, PhD > > > Assistant Professor > > > Biology Department > > > San Diego State University > > > 5500 Campanile Dr > > > San Diego 92182 > > > California > > > > > > > >

1 0