August 2011 - Mg-rast - mailman3.cels.anl.gov

Re: [mg-rast] [mgrastdev] Fwd: (Job 812 , ID 4440955.3) . is now publicly available.
by William Trimble 04 Aug '11

04 Aug '11

This is from v2. Does this mean we should remove the "make job public" from the v2 site? w On Thu, Aug 4, 2011 at 2:37 PM, Mark DSouza <dsouza(a)mcs.anl.gov> wrote: > Is this from the V2 site? > mark > > ----- Original Message ----- >> From: "Tobias Paczian" <paczian(a)mcs.anl.gov> >> To: "Travis Harrison" <teharrison(a)anl.gov> >> Cc: "mg-rast dev" <mgrastdev(a)mcs.anl.gov> >> Sent: Thursday, August 4, 2011 6:46:17 AM >> Subject: Re: [mgrastdev] Fwd: [mg-rast] (Job 812 , ID 4440955.3) . is now publicly available. >> Funnily enough, this text does not occur in either CVS or prod, dev or >> test sites. The current version does not have the reference error in >> it and a different message body. >> >> >> Not sure how this could happen. >> >> >> -- Tobi >> >> >> >> >> >> On Aug 3, 2011, at 9:19 AM, Travis Harrison wrote: >> >> >> >> Anyone know how did this email got out? The job is still flagged as >> not public in the DB, and has no metadata. Does something other than >> the PublishGenome page send out this email? >> >> - Travis >> >> >> ---------- Forwarded message ---------- >> From: < mg-rast(a)mcs.anl.gov > >> Date: Wed, Aug 3, 2011 at 4:13 AM >> Subject: [mg-rast] (Job 812 , ID 4440955.3) . is now publicly >> available. >> To: mg-rast(a)mcs.anl.gov >> >> >> Jamie Newbold (WebServerBackend::User=HASH(0x10203408)) has made the >> genome public. Link provided: >> http://mg-rast.mcs.anl.gov/mg-rast/FIG/linkin.cgi?metagenome=4440955.3 >> . >> >> >> _______________________________________________ >> mgrastdev mailing list >> mgrastdev(a)mcs.anl.gov >> https://lists.mcs.anl.gov/mailman/listinfo/mgrastdev >> >> _______________________________________________ >> mgrastdev mailing list >> mgrastdev(a)mcs.anl.gov >> https://lists.mcs.anl.gov/mailman/listinfo/mgrastdev > _______________________________________________ > mgrastdev mailing list > mgrastdev(a)mcs.anl.gov > https://lists.mcs.anl.gov/mailman/listinfo/mgrastdev >

1 0

Re: [mg-rast] Problem with upload to mg-rast
by William Trimble 04 Aug '11

04 Aug '11

Several of your input files have invalid characters in the nucleotide sequences. This has caused them to fail. All of your samples named FL6, FL7, and FL8 contain the letters F, P, @, B, E, D, ^A, ^C, ^G, and ^T in a few of the sequences. FL5 didn't have this problem, but you'll need to upload it again. You will need to fix the input files so they don't have any symbols other than ACGT and N in the sequence. I hope this helps, and thanks for using MG-RAST. William Trimble --for the MG-RAST team For instance, 454Reads.RL6.fna.clean contains the sequence >GMRC2OW01AZ065 length=455 xy=0293_1151 region=1 run=R_2010_08_25_13_00_14_ CTGGGGCATCGCTGGCTGCTGGAGCAAGCCGCTCGCC^AGTGCGACTGGCTGCATCTTTTC GTGGTGAAGGAAGATGCT^TCATTTTTCAGBTACAAGGATCGCGTGGCGCTGATCGAGCAG GGGATCGCCGGGAACFATAACGTGACCCTGCATCCGGGATCGTCCTATCTGATBTCGCGC G^CCACTTTCCC^CGGCTACTTCCTGAAAGACAAAGGCGT^GGTTGACGATTGCCACTGCCAG ATCGATCTGCAGCTGTTTCGCGAACATTTAGCTCCGGCGCTGGGGGTCACCCACCGCTTT GTCGGBAGCGAACCGCTGTGCGAATTAACCCGTAATTACAACCTGCGTATGCGACAGCTG CTGGAAGCGCCC^GGCGACGCGCCE@CCATTGAAGTGGTTGAGCTGGCGCGGGTTGAGAAG AGGCGCGCCGATTTCCGCGTTCCGGGTGCGCAAGC On Thu, Aug 4, 2011 at 2:11 PM, William Trimble <wltrimbl(a)gmail.com> wrote: > We're looking into why your jobs aren't progressing. > > We'll get back to you when we know more. > > William Trimble > --for the MG-RAST team > > On Thu, Aug 4, 2011 at 1:51 PM, Pedro Feijão <pedrofeijao1975(a)gmail.com> wrote: >> Hi, >> my name is Pedro and I am a PhD student from Unicamp, Brazil. First of all, >> let me thank you for making this great tool available, it has been very >> useful. >> In the past 2 or 3 days I have uploaded a compressed file with 8 fasta >> files, and the next day the results were ready, really amazing. But then I >> uploaded another files, and it never gets past the "processing upload >> phase", it has been more than a day now. I can't get to the point were I >> actually start the job. Can someone help me? My login is 'pedrofeijao'. >> Thanks! >> Pedro Feijao >> pedrofeijao1975(a)gmail.com >> >

1 0

Re: [mg-rast] Problem with upload to mg-rast
by William Trimble 04 Aug '11

04 Aug '11

We're looking into why your jobs aren't progressing. We'll get back to you when we know more. William Trimble --for the MG-RAST team On Thu, Aug 4, 2011 at 1:51 PM, Pedro Feijão <pedrofeijao1975(a)gmail.com> wrote: > Hi, > my name is Pedro and I am a PhD student from Unicamp, Brazil. First of all, > let me thank you for making this great tool available, it has been very > useful. > In the past 2 or 3 days I have uploaded a compressed file with 8 fasta > files, and the next day the results were ready, really amazing. But then I > uploaded another files, and it never gets past the "processing upload > phase", it has been more than a day now. I can't get to the point were I > actually start the job. Can someone help me? My login is 'pedrofeijao'. > Thanks! > Pedro Feijao > pedrofeijao1975(a)gmail.com >

1 0

Problem with upload to mg-rast
by Pedro Feijão 04 Aug '11

04 Aug '11

Hi, my name is Pedro and I am a PhD student from Unicamp, Brazil. First of all, let me thank you for making this great tool available, it has been very useful. In the past 2 or 3 days I have uploaded a compressed file with 8 fasta files, and the next day the results were ready, really amazing. But then I uploaded another files, and it never gets past the "processing upload phase", it has been more than a day now. I can't get to the point were I actually start the job. Can someone help me? My login is 'pedrofeijao'. Thanks! Pedro Feijao pedrofeijao1975(a)gmail.com

1 0

Re: [mg-rast] problem with very large sff file uploaded and processed incorrectly
by William Trimble 04 Aug '11

04 Aug '11

We can add genomes to the list of model organisms for which MG-RAST provides subtractive read filters. Is the Ciona intestinalis v2 genome assembly, from 2005, the most recent/suitable genome ? http://genome.jgi-psf.org/Cioin2/Cioin2.download.ftp.html Are there any other organisms that you can suggest we add to the list of organisms to screen against? Dog, chicken, and sea squirt are already on the list. William Trimble --for the MG-RAST team On Wed, Aug 3, 2011 at 11:31 AM, William Trimble <wltrimbl(a)gmail.com> wrote: > MG-RAST has a sequence-subtracting filter that > can remove sequences matching > human, cow, mouse, fruit fly, arabidopsis, or E. Coli > before the sequences enter the similarity pipeline. > > At present we don't have a function to screen against > Ciona intestinalis, sorry. > > William Trimble > --for the MG-RAST team > > > On Wed, Aug 3, 2011 at 11:17 AM, Alison Murray <Alison.Murray(a)dri.edu> wrote: >> >> Thanks William. >> >> Do you know if there's any way to add the Ciona intestinalis genome to use >> as a reference genome to subtract sequences from this whole data set? (I'm >> not actually sure at this point whether it would even work well for >> subtraction - but at least it's in the right phylum as my host organism). >> >> I guess I'll find out how much contamination there is following the analysis >> - but it would be helpful to add not the top few model organisms (I'd think >> that Ciona would have been a choice actually). >> >> Cheers, >> Alison >> >> >> ----- Original Message ----- >> From: William Trimble <wltrimbl(a)gmail.com> >> Date: Wednesday, August 3, 2011 7:08 am >> Subject: Re: [mg-rast] problem with very large sff file uploaded and >> processed incorrectly >> To: Alison Murray <Alison.Murray(a)dri.edu>, mg-rast(a)mcs.anl.gov >> >>> We got 1.57 M sequences from the file you uploaded >>> last night, so it looks like it came through this time. >>> >>> It should go through the pipeline now. >>> >>> We'll have to delete the broken job for you. >>> >>> William Trimble >>> --for the MG-RAST team >>> >>> On Wed, Aug 3, 2011 at 8:56 AM, Alison Murray >>> <Alison.Murray(a)dri.edu> wrote: >>> > Hi William, >>> > >>> > I uploaded a new dataset to replace the one that ran >>> incorrectly this last >>> > month. "Info: Your upload will be processed as job number 29212" >>> > >>> > You indicated that you'd check the file quality - that would >>> be much >>> > appreciated. >>> > >>> > I selected the options to dereplicated this data set as well >>> as dynamic >>> > trimming - phred score of 25 of max of 5 low quality bases per read. >>> > >>> > I tried to see if I could select the genome of Ciona >>> intestinalis as a model >>> > genome to screen against, but it did not seem that this was >>> possible. If >>> > that is possible, that is the closest organism with a genome >>> sequence that >>> > I'm aware of that could be used to screen against - as this is a >>> > host-associated microbiome metagenome that we've sequenced here. >>> > >>> > Also - if possible could you delete the Norsel3- >>> S_adreanum_MicrobiomeMG from >>> > my analysis cart (or can I delete it)? >>> > I'll be away for the next 2 hrs, then back around 9:15 am >>> PST. Much >>> > appreciate your help. >>> > >>> > >>> > >>> > ----- Original Message ----- >>> > From: William Trimble <wltrimbl(a)gmail.com> >>> > Date: Monday, August 1, 2011 12:00 pm >>> > Subject: Re: [mg-rast] problem with very large sff file >>> uploaded and >>> > processed incorrectly >>> > To: Alison Murray <Alison.Murray(a)dri.edu>, mg-rast(a)mcs.anl.gov >>> > >>> >> Both of the two recommended approaches (concatenated >>> >> FASTQ or separate SFF files) keep the per-base quality data. >>> >> >>> >> The FASTA format, on the other hand, doesn't retain the >>> >> quality scores for each read. >>> >> >>> >> William Trimble >>> >> --for the MG-RAST team >>> >> >>> >> On Mon, Aug 1, 2011 at 1:53 PM, Alison Murray >>> >> <Alison.Murray(a)dri.edu> wrote: >>> >> > ahh, >>> >> > >>> >> > OK. >>> >> > >>> >> > Is there information in the sff file that will be lost >>> >> (quality info?) that >>> >> > would make it better to run the two files separately? I might >>> >> also have the >>> >> > fastaq files. Or if not - can figure out how to prepare them. >>> >> > >>> >> > In terms of analysis - it's more attractive to have the whole >>> >> lot analyzed >>> >> > together - but I'm aware that quality is a critical issue. >>> >> What do you >>> >> > recommend then for the highest quality anlaysis? >>> >> > >>> >> > -Alison >>> >> > >>> >> > >>> >> > ----- Original Message ----- >>> >> > From: William Trimble <wltrimbl(a)gmail.com> >>> >> > Date: Monday, August 1, 2011 11:49 am >>> >> > Subject: Re: [mg-rast] problem with very large sff file >>> >> uploaded and >>> >> > processed incorrectly >>> >> > To: Alison Murray <Alison.Murray(a)dri.edu>, mg-rast(a)mcs.anl.gov >>> >> > >>> >> >> Oh, that's probably the reason, then. Concatenating >>> >> >> SFF files requires programs that deliberately write >>> >> >> SFF files. >>> >> >> >>> >> >> In that case, you could either send us the two SFF files >>> >> >> separately and run them as two separate jobs or >>> >> >> convert both runs to FASTQ and upload the concatenated >>> >> >> FASTQ. Either one will work with MG-RAST. >>> >> >> >>> >> >> William Trimble >>> >> >> --for the MG-RAST team >>> >> >> >>> >> >> On Mon, Aug 1, 2011 at 1:40 PM, Alison Murray >>> >> >> <Alison.Murray(a)dri.edu> wrote: >>> >> >> > OK, >>> >> >> > >>> >> >> > will start that shortly. I did combine two sff files >>> into the >>> >> >> one that I >>> >> >> > uploaded; I wonder if that caused the problem? I wanted to >>> >> >> join all the >>> >> >> > sequence I have from this data set into one analysis - >>> we had >>> >> >> a small set of >>> >> >> > data from the titration runs, and then the big main data set. >>> >> >> The file that >>> >> >> > I have to upload is the combined one (I concatenated the two >>> >> >> sff files). >>> >> >> > Actually - if you think that's a problem, let me know >>> and I'll >>> >> >> do them >>> >> >> > separately. It's all the same library though so would like >>> >> >> the analysis >>> >> >> > ideally to consider all the sequence files ran in these two >>> >> >> batches from the >>> >> >> > same data set. >>> >> >> > >>> >> >> > -Alison >>> >> >> > >>> >> >> > >>> >> >> > >>> >> >> > ----- Original Message ----- >>> >> >> > From: William Trimble <wltrimbl(a)gmail.com> >>> >> >> > Date: Monday, August 1, 2011 11:35 am >>> >> >> > Subject: Re: [mg-rast] problem with very large sff file >>> >> >> uploaded and >>> >> >> > processed incorrectly >>> >> >> > To: Alison Murray <Alison.Murray(a)dri.edu> >>> >> >> > >>> >> >> >> It appears that we don't have an intact copy >>> >> >> >> of your dataset. >>> >> >> >> >>> >> >> >> Yes, you should just upload the file, let us >>> >> >> >> know, and if it looks ok you can create a new job. >>> >> >> >> >>> >> >> >> William Trimble >>> >> >> >> --for the MG-RAST team >>> >> >> >> >>> >> >> >> >>> >> >> >> On Mon, Aug 1, 2011 at 1:25 PM, Alison Murray >>> >> >> >> <Alison.Murray(a)dri.edu> wrote: >>> >> >> >> > Hi William, >>> >> >> >> > >>> >> >> >> > The numbers are slightly different from what I see. >>> I think >>> >> >> >> that I >>> >> >> >> > compressed a 7,539,547 SFF file - such that the one >>> that was >>> >> >> >> uploaded was >>> >> >> >> > 3,651,001. (File name Norsel3MG_all.sff). >>> >> >> >> > >>> >> >> >> > Should I go ahead and try and upload through the MGRAST >>> >> >> >> browser this >>> >> >> >> > compressed file? >>> >> >> >> > >>> >> >> >> > From what you suggest - I think the answer is yes, but >>> >> am not >>> >> >> >> sure of the >>> >> >> >> > differences in file size. >>> >> >> >> > >>> >> >> >> > -Alison >>> >> >> >> > >>> >> >> >> > >>> >> >> >> > >>> >> >> >> > >>> >> >> >> > ----- Original Message ----- >>> >> >> >> > From: William Trimble <wltrimbl(a)gmail.com> >>> >> >> >> > Date: Monday, August 1, 2011 11:18 am >>> >> >> >> > Subject: Re: [mg-rast] problem with very large sff file >>> >> >> >> uploaded and >>> >> >> >> > processed incorrectly >>> >> >> >> > To: Alison Murray <Alison.Murray(a)dri.edu>, mg- >>> >> rast(a)mcs.anl.gov>> >> > >>> >> >> >> >> Thank you for letting us know you're having trouble. >>> >> >> >> >> >>> >> >> >> >> You uploaded a compressed 7 Gb SFF file, but >>> >> >> >> >> the file had a problem that caused us to find >>> >> >> >> >> only 74 reads in it. >>> >> >> >> >> >>> >> >> >> >> This problem was probably caused by an error during the >>> >> >> >> >> upload process. >>> >> >> >> >> >>> >> >> >> >> The SFF file that we got was 7720495172 bytes long. >>> >> >> >> >> does this match the size of the file that you sent? >>> >> >> >> >> >>> >> >> >> >> You will need to upload the compressed SFF file again. >>> >> >> >> >> We can then check to make sure it is complete. >>> >> >> >> >> >>> >> >> >> >> William Trimble >>> >> >> >> >> --for the MG-RAST team >>> >> >> >> >> >>> >> >> >> >> >>> >> >> >> >> On Mon, Aug 1, 2011 at 12:40 PM, Alison Murray >>> >> >> >> >> <Alison.Murray(a)dri.edu> wrote: >>> >> >> >> >> > Hi there, >>> >> >> >> >> > >>> >> >> >> >> > I uploaded a very large file - over 3.6GB that was >>> a sff >>> >> >> >> file (name: >>> >> >> >> >> > Norsel3-S_adreanum_MicrobiomeMG) a few weeks ago - >>> >> this was >>> >> >> >> >> submitted for >>> >> >> >> >> > analysis - and today I checked, and it was >>> "available for >>> >> >> >> analysis".>> > However, it appears that only a very small >>> >> >> >> portion of the >>> >> >> >> >> sequences were >>> >> >> >> >> > actually uploaded/processed. I'm wondering if >>> >> somehow the >>> >> >> >> >> criteria for QC >>> >> >> >> >> > was too strict? Or if I crashed the server??? Really >>> >> >> have no >>> >> >> >> >> clue as to why >>> >> >> >> >> > it didn't work - but definitely a problem here. This >>> >> is a >>> >> >> >> >> huge metagenome >>> >> >> >> >> > data set - generated with 454. >>> >> >> >> >> > >>> >> >> >> >> > Would appreciate it if someone could help me with >>> >> this - as >>> >> >> >> >> it's literally >>> >> >> >> >> > be 3 weeks waiting to then see that something >>> didn't work >>> >> >> >> >> right - in the >>> >> >> >> >> > upload/processing settings were mostly the default >>> >> >> settings as >>> >> >> >> >> far as I >>> >> >> >> >> > recall. I uploaded the raw, non-assembled data set. >>> >> (supposed>> >> >> to be 865 MB >>> >> >> >> >> > of raw sequence) >>> >> >> >> >> > >>> >> >> >> >> > Thanks for the help! >>> >> >> >> >> > >>> >> >> >> >> > Alison >>> >> >> >> >> > >>> >> >> >> >> > >>> >> >> >> >> > >>> >> >> >> >> > Alison E. Murray, Ph.D.// >>> >> >> >> >> > Associate Research Professor// >>> >> >> >> >> > Desert Research Institute// >>> >> >> >> >> > 2215 Raggio Parkway// >>> >> >> >> >> > Reno, NV 89512// >>> >> >> >> >> > >>> >> >> >> >> > Tel: 775 673 7361// >>> >> >> >> >> > FAX: 775 673 7635// >>> >> >> >> >> > http://www.dri.edu/People/alison/ >>> >> >> >> >> > >>> >> >> >> >> > >>> >> >> >> > >>> >> >> >> > Alison E. Murray, Ph.D.// >>> >> >> >> > Associate Research Professor// >>> >> >> >> > Desert Research Institute// >>> >> >> >> > 2215 Raggio Parkway// >>> >> >> >> > Reno, NV 89512// >>> >> >> >> > >>> >> >> >> > Tel: 775 673 7361// >>> >> >> >> > FAX: 775 673 7635// >>> >> >> >> > http://www.dri.edu/People/alison/ >>> >> >> >> > >>> >> >> >> > >>> >> >> > >>> >> >> > Alison E. Murray, Ph.D.// >>> >> >> > Associate Research Professor// >>> >> >> > Desert Research Institute// >>> >> >> > 2215 Raggio Parkway// >>> >> >> > Reno, NV 89512// >>> >> >> > >>> >> >> > Tel: 775 673 7361// >>> >> >> > FAX: 775 673 7635// >>> >> >> > http://www.dri.edu/People/alison/ >>> >> >> > >>> >> >> > >>> >> > >>> >> > Alison E. Murray, Ph.D.// >>> >> > Associate Research Professor// >>> >> > Desert Research Institute// >>> >> > 2215 Raggio Parkway// >>> >> > Reno, NV 89512// >>> >> > >>> >> > Tel: 775 673 7361// >>> >> > FAX: 775 673 7635// >>> >> > http://www.dri.edu/People/alison/ >>> >> > >>> >> > >>> > >>> > Alison E. Murray, Ph.D.// >>> > Associate Research Professor// >>> > Desert Research Institute// >>> > 2215 Raggio Parkway// >>> > Reno, NV 89512// >>> > >>> > Tel: 775 673 7361// >>> > FAX: 775 673 7635// >>> > http://www.dri.edu/People/alison/ >>> > >>> > >> >> Alison E. Murray, Ph.D.// >> Associate Research Professor// >> Desert Research Institute// >> 2215 Raggio Parkway// >> Reno, NV 89512// >> >> Tel: 775 673 7361// >> FAX: 775 673 7635// >> http://www.dri.edu/People/alison/ >> >> >

1 0

Re: [mg-rast] MID listing
by Steve Kemp 04 Aug '11

04 Aug '11

Dear Folker Thanks for this and thanks for your help with MG-RAST. This is an area and demand that is certain to grow here as we take on new projects looking broadly at human-animal health interactions. George described our present hardware setup, however we are developing proposals to create what might be called local 'sub clouds'. Connectivity within the region is typically excellent, the cost and bandwidth limitations kick-in when we try to move data to and from the rest of the world. So we are working with IGS around the idea of a DIAG node (www.diagcomputing.org) This could allow us here at ILRI to provide very high performance computing to Africa-based scientists as well as overcoming our own bottlenecks. MG-RAST is exactly the sort of application that might leverage such a development. I am not sure if a DIAG-like cloud based here could serve as a platform for MG-RAST, or if it could be used to relive some of the bandwidth requirements. I would appreciate your comments on this. So, in summary, yes we are extremely interested in exploring a collaboration. Best wishes Steve On 4 Aug 2011, at 14:24, George Michuki wrote: > Dear Folker, > > Thanks for your quick response. I thought you would be in bed at this hour! We are very much interested in being a partner in Africa. Would like to bring on board Alan Orth (our linux/server administrator) and Steve Kemp (project leader) to initiate discussions towards partnering. Would it be OK with you if we could arrange for a teleconference meeting? > > Regards, > > George > > On 08/04/2011 02:05 PM, Folker Meyer wrote: >> Dear George, >> >> thanks for the kind offer and the praise of MG-RAST. I'd be interested to learn about the experience using tools like mg-rast on the African continent. (In Europe the internet connections typically allow very smooth usage). >> >> However MG-RAST uses about a dozen machines of the type and size you described as the runtime infrastructure for the web component, several hundred computers are used to compute the analysis (for our highly optimized pipeline). If you indeed find wait times for a) the web interface or b) the computational analysis too long, please let us know. >> >> We are about to roll out a "cloud" based MG-RAST client, that will allow the usage of local CPU power for the analysis of MG-RAST jobs submitted by a specific user on their local machines. Display and storage would still be centralized. >> >> We'd be interested in finding a partner in africa for this project. >> >> Best, >> Folker Meyer (for the MG-RAST team). >> >> >> On Aug 4, 2011, at 3:41 AM, George Michuki wrote: >> >>> Dear William and MG-rast team, >>> >>> I am impressed with MG-RAST and after discussing with my project leader at ILRI we have a proposal to make to MG-RAST. We have a 454 platform at ILRI and its the only one accessible for research use by other scientists working in Africa. So our proposal to you is that you set up a mirror in our server at ILRI for use by African researchers? We have a new server with, Quad Eight-core Xeon processors (32 cores total), 128 GB of RAM and 8 TB disk space that we are underutilising at the moment. This would provide shorter waiting periods for data analysis. Let me know whether that is possible and we would be willing to meet any cost implications of setting up the mirror system. Please feel free to give any thoughts you have on this venture. >>> >>> Regards, >>> >>> George >>> >>> On 08/03/2011 08:13 PM, William Trimble wrote: >>>> All of your sequences begin with the four-base tag GACT. >>>> Most then have one of the barcodes in the first column above. >>>> >>>> MG-RAST is expecting the MID codes with GACT prepended: >>>> >>>> GACTACACGACGACT RL1 >>>> GACTACACGTAGTAT RL2 >>>> GACTACACTACTCGT RL3 >>>> GACTACGACACGTAT RL4 >>>> GACTACGAGTAGACT RL5 >>>> GACTACGCGTCTAGT RL6 >>>> GACTACGTACACACT RL7 >>>> GACTACGTACTGTGT RL8 >>>> GACTACGTAGATCGT RL9 >>>> GACTACTACGTCTCT RL10 >>>> GACTACTATACGAGT RL11 >>>> GACTACTCGCGTCGT RL12 >>>> GACTAGACTCGACGT RL13 >>>> GACTAGTACGAGAGT RL14 >>>> GACTAGTACTACTAT RL15 >>>> GACTAGTAGACGTCT RL16 >>>> GACTAGTCGTACACT RL17 >>>> GACTAGTGTAGTAGT RL18 >>>> GACTATAGTATACGT RL19 >>>> >>>> If you use these 15-letter sequences as the MIDs >>>> your dataset should demultiplex smoothly. >>>> >>>> William Trimble >>>> --for the MG-RAST team >>>> >>>> On Wed, Aug 3, 2011 at 11:35 AM, William Trimble<wltrimbl(a)gmail.com> wrote: >>>>> We're looking at your data and will get back to you shortly. >>>>> >>>>> William Trimble >>>>> --for the MG-RAST team >>>>> >>>>> On Wed, Aug 3, 2011 at 11:17 AM, George Michuki<g.michuki(a)cgiar.org> wrote: >>>>>> Hi, >>>>>> >>>>>> How should I list the MID sequences in MGRAST user input? I have used MIDs >>>>>> 1 to 19 which in GS software they appear as below: >>>>>> >>>>>> mid = "RL1", "ACACGACGACT", 2, "AGTCGTGGTGT"; >>>>>> mid = "RL2", "ACACGTAGTAT", 2, "ATACTAGGTGT"; >>>>>> mid = "RL3", "ACACTACTCGT", 2, "ACGAGTGGTGT"; >>>>>> mid = "RL4", "ACGACACGTAT", 2, "ATACGTGGCGT"; >>>>>> mid = "RL5", "ACGAGTAGACT", 2, "AGTCTACGCGT"; >>>>>> mid = "RL6", "ACGCGTCTAGT", 2, "ACTAGAGGCGT"; >>>>>> mid = "RL7", "ACGTACACACT", 2, "AGTGTGTGCGT"; >>>>>> mid = "RL8", "ACGTACTGTGT", 2, "ACACAGTGCGT"; >>>>>> mid = "RL9", "ACGTAGATCGT", 2, "ACGATCTGCGT"; >>>>>> mid = "RL10", "ACTACGTCTCT", 2, "AGAGACGGAGT"; >>>>>> mid = "RL11", "ACTATACGAGT", 2, "ACTCGTAGAGT"; >>>>>> mid = "RL12", "ACTCGCGTCGT", 2, "ACGACGGGAGT"; >>>>>> mid = "RL13", "AGACTCGACGT", 2, "ACGTCGGGTCT"; >>>>>> mid = "RL14", "AGTACGAGAGT", 2, "ACTCTCGGACT"; >>>>>> mid = "RL15", "AGTACTACTAT", 2, "ATAGTAGGACT"; >>>>>> mid = "RL16", "AGTAGACGTCT", 2, "AGACGTCGACT"; >>>>>> mid = "RL17", "AGTCGTACACT", 2, "AGTGTAGGACT"; >>>>>> mid = "RL18", "AGTGTAGTAGT", 2, "ACTACTAGACT"; >>>>>> mid = "RL19", "ATAGTATACGT", 2, "ACGTATAGTAT"; >>>>>> >>>>>> I tried listing just the 1st sequence without its reverse complement and no >>>>>> multiplexing was found. Tried listing both and its taken over 30 min >>>>>> without any feedback from the software. Please assist. >>>>>> >>>>>> Regards, >>>>>> >>>>>> George >>>>>> >>>>>> ______________________________________________________________________ This email has been scanned by the MessageLabs Email Security System. For more information please visit http://www.messagelabs.com/email ______________________________________________________________________

1 0

Re: [mg-rast] MID listing
by George Michuki 04 Aug '11

04 Aug '11

Dear Folker, Thanks for your quick response. I thought you would be in bed at this hour! We are very much interested in being a partner in Africa. Would like to bring on board Alan Orth (our linux/server administrator) and Steve Kemp (project leader) to initiate discussions towards partnering. Would it be OK with you if we could arrange for a teleconference meeting? Regards, George On 08/04/2011 02:05 PM, Folker Meyer wrote: > Dear George, > > thanks for the kind offer and the praise of MG-RAST. I'd be interested to learn about the experience using tools like mg-rast on the African continent. (In Europe the internet connections typically allow very smooth usage). > > However MG-RAST uses about a dozen machines of the type and size you described as the runtime infrastructure for the web component, several hundred computers are used to compute the analysis (for our highly optimized pipeline). If you indeed find wait times for a) the web interface or b) the computational analysis too long, please let us know. > > We are about to roll out a "cloud" based MG-RAST client, that will allow the usage of local CPU power for the analysis of MG-RAST jobs submitted by a specific user on their local machines. Display and storage would still be centralized. > > We'd be interested in finding a partner in africa for this project. > > Best, > Folker Meyer (for the MG-RAST team). > > > On Aug 4, 2011, at 3:41 AM, George Michuki wrote: > >> Dear William and MG-rast team, >> >> I am impressed with MG-RAST and after discussing with my project leader at ILRI we have a proposal to make to MG-RAST. We have a 454 platform at ILRI and its the only one accessible for research use by other scientists working in Africa. So our proposal to you is that you set up a mirror in our server at ILRI for use by African researchers? We have a new server with, Quad Eight-core Xeon processors (32 cores total), 128 GB of RAM and 8 TB disk space that we are underutilising at the moment. This would provide shorter waiting periods for data analysis. Let me know whether that is possible and we would be willing to meet any cost implications of setting up the mirror system. Please feel free to give any thoughts you have on this venture. >> >> Regards, >> >> George >> >> On 08/03/2011 08:13 PM, William Trimble wrote: >>> All of your sequences begin with the four-base tag GACT. >>> Most then have one of the barcodes in the first column above. >>> >>> MG-RAST is expecting the MID codes with GACT prepended: >>> >>> GACTACACGACGACT RL1 >>> GACTACACGTAGTAT RL2 >>> GACTACACTACTCGT RL3 >>> GACTACGACACGTAT RL4 >>> GACTACGAGTAGACT RL5 >>> GACTACGCGTCTAGT RL6 >>> GACTACGTACACACT RL7 >>> GACTACGTACTGTGT RL8 >>> GACTACGTAGATCGT RL9 >>> GACTACTACGTCTCT RL10 >>> GACTACTATACGAGT RL11 >>> GACTACTCGCGTCGT RL12 >>> GACTAGACTCGACGT RL13 >>> GACTAGTACGAGAGT RL14 >>> GACTAGTACTACTAT RL15 >>> GACTAGTAGACGTCT RL16 >>> GACTAGTCGTACACT RL17 >>> GACTAGTGTAGTAGT RL18 >>> GACTATAGTATACGT RL19 >>> >>> If you use these 15-letter sequences as the MIDs >>> your dataset should demultiplex smoothly. >>> >>> William Trimble >>> --for the MG-RAST team >>> >>> On Wed, Aug 3, 2011 at 11:35 AM, William Trimble<wltrimbl(a)gmail.com> wrote: >>>> We're looking at your data and will get back to you shortly. >>>> >>>> William Trimble >>>> --for the MG-RAST team >>>> >>>> On Wed, Aug 3, 2011 at 11:17 AM, George Michuki<g.michuki(a)cgiar.org> wrote: >>>>> Hi, >>>>> >>>>> How should I list the MID sequences in MGRAST user input? I have used MIDs >>>>> 1 to 19 which in GS software they appear as below: >>>>> >>>>> mid = "RL1", "ACACGACGACT", 2, "AGTCGTGGTGT"; >>>>> mid = "RL2", "ACACGTAGTAT", 2, "ATACTAGGTGT"; >>>>> mid = "RL3", "ACACTACTCGT", 2, "ACGAGTGGTGT"; >>>>> mid = "RL4", "ACGACACGTAT", 2, "ATACGTGGCGT"; >>>>> mid = "RL5", "ACGAGTAGACT", 2, "AGTCTACGCGT"; >>>>> mid = "RL6", "ACGCGTCTAGT", 2, "ACTAGAGGCGT"; >>>>> mid = "RL7", "ACGTACACACT", 2, "AGTGTGTGCGT"; >>>>> mid = "RL8", "ACGTACTGTGT", 2, "ACACAGTGCGT"; >>>>> mid = "RL9", "ACGTAGATCGT", 2, "ACGATCTGCGT"; >>>>> mid = "RL10", "ACTACGTCTCT", 2, "AGAGACGGAGT"; >>>>> mid = "RL11", "ACTATACGAGT", 2, "ACTCGTAGAGT"; >>>>> mid = "RL12", "ACTCGCGTCGT", 2, "ACGACGGGAGT"; >>>>> mid = "RL13", "AGACTCGACGT", 2, "ACGTCGGGTCT"; >>>>> mid = "RL14", "AGTACGAGAGT", 2, "ACTCTCGGACT"; >>>>> mid = "RL15", "AGTACTACTAT", 2, "ATAGTAGGACT"; >>>>> mid = "RL16", "AGTAGACGTCT", 2, "AGACGTCGACT"; >>>>> mid = "RL17", "AGTCGTACACT", 2, "AGTGTAGGACT"; >>>>> mid = "RL18", "AGTGTAGTAGT", 2, "ACTACTAGACT"; >>>>> mid = "RL19", "ATAGTATACGT", 2, "ACGTATAGTAT"; >>>>> >>>>> I tried listing just the 1st sequence without its reverse complement and no >>>>> multiplexing was found. Tried listing both and its taken over 30 min >>>>> without any feedback from the software. Please assist. >>>>> >>>>> Regards, >>>>> >>>>> George >>>>> >>>>>

1 0

Re: [mg-rast] MID listing
by Folker Meyer 04 Aug '11

04 Aug '11

Dear George, thanks for the kind offer and the praise of MG-RAST. I'd be interested to learn about the experience using tools like mg-rast on the African continent. (In Europe the internet connections typically allow very smooth usage). However MG-RAST uses about a dozen machines of the type and size you described as the runtime infrastructure for the web component, several hundred computers are used to compute the analysis (for our highly optimized pipeline). If you indeed find wait times for a) the web interface or b) the computational analysis too long, please let us know. We are about to roll out a "cloud" based MG-RAST client, that will allow the usage of local CPU power for the analysis of MG-RAST jobs submitted by a specific user on their local machines. Display and storage would still be centralized. We'd be interested in finding a partner in africa for this project. Best, Folker Meyer (for the MG-RAST team). On Aug 4, 2011, at 3:41 AM, George Michuki wrote: > Dear William and MG-rast team, > > I am impressed with MG-RAST and after discussing with my project leader at ILRI we have a proposal to make to MG-RAST. We have a 454 platform at ILRI and its the only one accessible for research use by other scientists working in Africa. So our proposal to you is that you set up a mirror in our server at ILRI for use by African researchers? We have a new server with, Quad Eight-core Xeon processors (32 cores total), 128 GB of RAM and 8 TB disk space that we are underutilising at the moment. This would provide shorter waiting periods for data analysis. Let me know whether that is possible and we would be willing to meet any cost implications of setting up the mirror system. Please feel free to give any thoughts you have on this venture. > > Regards, > > George > > On 08/03/2011 08:13 PM, William Trimble wrote: >> All of your sequences begin with the four-base tag GACT. >> Most then have one of the barcodes in the first column above. >> >> MG-RAST is expecting the MID codes with GACT prepended: >> >> GACTACACGACGACT RL1 >> GACTACACGTAGTAT RL2 >> GACTACACTACTCGT RL3 >> GACTACGACACGTAT RL4 >> GACTACGAGTAGACT RL5 >> GACTACGCGTCTAGT RL6 >> GACTACGTACACACT RL7 >> GACTACGTACTGTGT RL8 >> GACTACGTAGATCGT RL9 >> GACTACTACGTCTCT RL10 >> GACTACTATACGAGT RL11 >> GACTACTCGCGTCGT RL12 >> GACTAGACTCGACGT RL13 >> GACTAGTACGAGAGT RL14 >> GACTAGTACTACTAT RL15 >> GACTAGTAGACGTCT RL16 >> GACTAGTCGTACACT RL17 >> GACTAGTGTAGTAGT RL18 >> GACTATAGTATACGT RL19 >> >> If you use these 15-letter sequences as the MIDs >> your dataset should demultiplex smoothly. >> >> William Trimble >> --for the MG-RAST team >> >> On Wed, Aug 3, 2011 at 11:35 AM, William Trimble<wltrimbl(a)gmail.com> wrote: >>> We're looking at your data and will get back to you shortly. >>> >>> William Trimble >>> --for the MG-RAST team >>> >>> On Wed, Aug 3, 2011 at 11:17 AM, George Michuki<g.michuki(a)cgiar.org> wrote: >>>> Hi, >>>> >>>> How should I list the MID sequences in MGRAST user input? I have used MIDs >>>> 1 to 19 which in GS software they appear as below: >>>> >>>> mid = "RL1", "ACACGACGACT", 2, "AGTCGTGGTGT"; >>>> mid = "RL2", "ACACGTAGTAT", 2, "ATACTAGGTGT"; >>>> mid = "RL3", "ACACTACTCGT", 2, "ACGAGTGGTGT"; >>>> mid = "RL4", "ACGACACGTAT", 2, "ATACGTGGCGT"; >>>> mid = "RL5", "ACGAGTAGACT", 2, "AGTCTACGCGT"; >>>> mid = "RL6", "ACGCGTCTAGT", 2, "ACTAGAGGCGT"; >>>> mid = "RL7", "ACGTACACACT", 2, "AGTGTGTGCGT"; >>>> mid = "RL8", "ACGTACTGTGT", 2, "ACACAGTGCGT"; >>>> mid = "RL9", "ACGTAGATCGT", 2, "ACGATCTGCGT"; >>>> mid = "RL10", "ACTACGTCTCT", 2, "AGAGACGGAGT"; >>>> mid = "RL11", "ACTATACGAGT", 2, "ACTCGTAGAGT"; >>>> mid = "RL12", "ACTCGCGTCGT", 2, "ACGACGGGAGT"; >>>> mid = "RL13", "AGACTCGACGT", 2, "ACGTCGGGTCT"; >>>> mid = "RL14", "AGTACGAGAGT", 2, "ACTCTCGGACT"; >>>> mid = "RL15", "AGTACTACTAT", 2, "ATAGTAGGACT"; >>>> mid = "RL16", "AGTAGACGTCT", 2, "AGACGTCGACT"; >>>> mid = "RL17", "AGTCGTACACT", 2, "AGTGTAGGACT"; >>>> mid = "RL18", "AGTGTAGTAGT", 2, "ACTACTAGACT"; >>>> mid = "RL19", "ATAGTATACGT", 2, "ACGTATAGTAT"; >>>> >>>> I tried listing just the 1st sequence without its reverse complement and no >>>> multiplexing was found. Tried listing both and its taken over 30 min >>>> without any feedback from the software. Please assist. >>>> >>>> Regards, >>>> >>>> George >>>> >>>>

1 0

Re: [mg-rast] MID listing
by George Michuki 04 Aug '11

04 Aug '11

Dear William and MG-rast team, I am impressed with MG-RAST and after discussing with my project leader at ILRI we have a proposal to make to MG-RAST. We have a 454 platform at ILRI and its the only one accessible for research use by other scientists working in Africa. So our proposal to you is that you set up a mirror in our server at ILRI for use by African researchers? We have a new server with, Quad Eight-core Xeon processors (32 cores total), 128 GB of RAM and 8 TB disk space that we are underutilising at the moment. This would provide shorter waiting periods for data analysis. Let me know whether that is possible and we would be willing to meet any cost implications of setting up the mirror system. Please feel free to give any thoughts you have on this venture. Regards, George On 08/03/2011 08:13 PM, William Trimble wrote: > All of your sequences begin with the four-base tag GACT. > Most then have one of the barcodes in the first column above. > > MG-RAST is expecting the MID codes with GACT prepended: > > GACTACACGACGACT RL1 > GACTACACGTAGTAT RL2 > GACTACACTACTCGT RL3 > GACTACGACACGTAT RL4 > GACTACGAGTAGACT RL5 > GACTACGCGTCTAGT RL6 > GACTACGTACACACT RL7 > GACTACGTACTGTGT RL8 > GACTACGTAGATCGT RL9 > GACTACTACGTCTCT RL10 > GACTACTATACGAGT RL11 > GACTACTCGCGTCGT RL12 > GACTAGACTCGACGT RL13 > GACTAGTACGAGAGT RL14 > GACTAGTACTACTAT RL15 > GACTAGTAGACGTCT RL16 > GACTAGTCGTACACT RL17 > GACTAGTGTAGTAGT RL18 > GACTATAGTATACGT RL19 > > If you use these 15-letter sequences as the MIDs > your dataset should demultiplex smoothly. > > William Trimble > --for the MG-RAST team > > On Wed, Aug 3, 2011 at 11:35 AM, William Trimble<wltrimbl(a)gmail.com> wrote: >> We're looking at your data and will get back to you shortly. >> >> William Trimble >> --for the MG-RAST team >> >> On Wed, Aug 3, 2011 at 11:17 AM, George Michuki<g.michuki(a)cgiar.org> wrote: >>> Hi, >>> >>> How should I list the MID sequences in MGRAST user input? I have used MIDs >>> 1 to 19 which in GS software they appear as below: >>> >>> mid = "RL1", "ACACGACGACT", 2, "AGTCGTGGTGT"; >>> mid = "RL2", "ACACGTAGTAT", 2, "ATACTAGGTGT"; >>> mid = "RL3", "ACACTACTCGT", 2, "ACGAGTGGTGT"; >>> mid = "RL4", "ACGACACGTAT", 2, "ATACGTGGCGT"; >>> mid = "RL5", "ACGAGTAGACT", 2, "AGTCTACGCGT"; >>> mid = "RL6", "ACGCGTCTAGT", 2, "ACTAGAGGCGT"; >>> mid = "RL7", "ACGTACACACT", 2, "AGTGTGTGCGT"; >>> mid = "RL8", "ACGTACTGTGT", 2, "ACACAGTGCGT"; >>> mid = "RL9", "ACGTAGATCGT", 2, "ACGATCTGCGT"; >>> mid = "RL10", "ACTACGTCTCT", 2, "AGAGACGGAGT"; >>> mid = "RL11", "ACTATACGAGT", 2, "ACTCGTAGAGT"; >>> mid = "RL12", "ACTCGCGTCGT", 2, "ACGACGGGAGT"; >>> mid = "RL13", "AGACTCGACGT", 2, "ACGTCGGGTCT"; >>> mid = "RL14", "AGTACGAGAGT", 2, "ACTCTCGGACT"; >>> mid = "RL15", "AGTACTACTAT", 2, "ATAGTAGGACT"; >>> mid = "RL16", "AGTAGACGTCT", 2, "AGACGTCGACT"; >>> mid = "RL17", "AGTCGTACACT", 2, "AGTGTAGGACT"; >>> mid = "RL18", "AGTGTAGTAGT", 2, "ACTACTAGACT"; >>> mid = "RL19", "ATAGTATACGT", 2, "ACGTATAGTAT"; >>> >>> I tried listing just the 1st sequence without its reverse complement and no >>> multiplexing was found. Tried listing both and its taken over 30 min >>> without any feedback from the software. Please assist. >>> >>> Regards, >>> >>> George >>> >>>

1 0

Re: [mg-rast] MID listing
by William Trimble 03 Aug '11

03 Aug '11

All of your sequences begin with the four-base tag GACT. Most then have one of the barcodes in the first column above. MG-RAST is expecting the MID codes with GACT prepended: GACTACACGACGACT RL1 GACTACACGTAGTAT RL2 GACTACACTACTCGT RL3 GACTACGACACGTAT RL4 GACTACGAGTAGACT RL5 GACTACGCGTCTAGT RL6 GACTACGTACACACT RL7 GACTACGTACTGTGT RL8 GACTACGTAGATCGT RL9 GACTACTACGTCTCT RL10 GACTACTATACGAGT RL11 GACTACTCGCGTCGT RL12 GACTAGACTCGACGT RL13 GACTAGTACGAGAGT RL14 GACTAGTACTACTAT RL15 GACTAGTAGACGTCT RL16 GACTAGTCGTACACT RL17 GACTAGTGTAGTAGT RL18 GACTATAGTATACGT RL19 If you use these 15-letter sequences as the MIDs your dataset should demultiplex smoothly. William Trimble --for the MG-RAST team On Wed, Aug 3, 2011 at 11:35 AM, William Trimble <wltrimbl(a)gmail.com> wrote: > We're looking at your data and will get back to you shortly. > > William Trimble > --for the MG-RAST team > > On Wed, Aug 3, 2011 at 11:17 AM, George Michuki <g.michuki(a)cgiar.org> wrote: >> Hi, >> >> How should I list the MID sequences in MGRAST user input? I have used MIDs >> 1 to 19 which in GS software they appear as below: >> >> mid = "RL1", "ACACGACGACT", 2, "AGTCGTGGTGT"; >> mid = "RL2", "ACACGTAGTAT", 2, "ATACTAGGTGT"; >> mid = "RL3", "ACACTACTCGT", 2, "ACGAGTGGTGT"; >> mid = "RL4", "ACGACACGTAT", 2, "ATACGTGGCGT"; >> mid = "RL5", "ACGAGTAGACT", 2, "AGTCTACGCGT"; >> mid = "RL6", "ACGCGTCTAGT", 2, "ACTAGAGGCGT"; >> mid = "RL7", "ACGTACACACT", 2, "AGTGTGTGCGT"; >> mid = "RL8", "ACGTACTGTGT", 2, "ACACAGTGCGT"; >> mid = "RL9", "ACGTAGATCGT", 2, "ACGATCTGCGT"; >> mid = "RL10", "ACTACGTCTCT", 2, "AGAGACGGAGT"; >> mid = "RL11", "ACTATACGAGT", 2, "ACTCGTAGAGT"; >> mid = "RL12", "ACTCGCGTCGT", 2, "ACGACGGGAGT"; >> mid = "RL13", "AGACTCGACGT", 2, "ACGTCGGGTCT"; >> mid = "RL14", "AGTACGAGAGT", 2, "ACTCTCGGACT"; >> mid = "RL15", "AGTACTACTAT", 2, "ATAGTAGGACT"; >> mid = "RL16", "AGTAGACGTCT", 2, "AGACGTCGACT"; >> mid = "RL17", "AGTCGTACACT", 2, "AGTGTAGGACT"; >> mid = "RL18", "AGTGTAGTAGT", 2, "ACTACTAGACT"; >> mid = "RL19", "ATAGTATACGT", 2, "ACGTATAGTAT"; >> >> I tried listing just the 1st sequence without its reverse complement and no >> multiplexing was found. Tried listing both and its taken over 30 min >> without any feedback from the software. Please assist. >> >> Regards, >> >> George >> >> >

1 0