February 2011 - Mg-rast - mailman3.cels.anl.gov

(Job 817 , ID 4440960.3) . is now publicly available.
by mg-rast＠mcs.anl.gov 25 Feb '11

25 Feb '11

Jennifer Biddle (WebServerBackend::User=HASH(0x13d11170)) has made the genome public. Link provided: http://mg-rast.mcs.anl.gov/mg-rast/FIG/linkin.cgi?metagenome=4440960.3.

1 0

Re: [mg-rast] 6 day jobs
by Mark D'Souza 25 Feb '11

25 Feb '11

Hi Iddo, They should be done some time this weekend or Monday, the time consuming BLAST computation is done. Again, sorry for the delay. Regards, Mark ----- Original Message ----- > From: "Iddo Friedberg" <idoerg(a)gmail.com> > To: "Mark D'Souza" <dsouza(a)mcs.anl.gov>, mg-rast(a)mcs.anl.gov > Sent: Thursday, February 24, 2011 7:14:40 AM > Subject: Re: [mg-rast] 6 day jobs > Hi Mark, > > Picking up on where we were before: my jobs are now about 3 weeks in > the queue. Any idea whn they will be ready? > > Iddo Friedberg > http://iddo-friedberg.net/contact.html > > > > On Feb 9, 2011 3:45 PM, "Mark D'Souza" < dsouza(a)mcs.anl.gov > > wrote: > > Hi Iddo, > > That would be one week from today, depending on machine availability. > Sorry, these last few months have been really busy. > > > > Mark > > ----- Original Message ----- > > From: "Iddo Friedberg" < idoerg(a)gmail.com > > > > To: "Mark D'Souza" < dsouza(a)mcs.anl.gov > > > Sent: Wednesday, February 9, 2011 12:13:45 PM > > Subject:...

1 0

Re: [mg-rast] Information
by Mark D'Souza 25 Feb '11

25 Feb '11

Hi, The time taken depends on the size of the data set in base pairs (number of sequences as well as sequence length), availability of the shared computing resources and the number and size of the MG-RAST jobs in the queue. The time taken is between 2 and 3 weeks for recent jobs, though that can change. ----- Original Message ----- > From: "Valeria Lentini" <vlentini(a)unime.it> > To: "." <mg-rast(a)mcs.anl.gov> > Sent: Friday, February 25, 2011 3:17:10 PM > Subject: [mg-rast] Information > Dear MG-RAST Staff, > > I'm PhD from Italy, I'm working with metagenomic data and I have > discovered MG-RAST. I just want to know how much time employ to > analyse 1,500,000 sequences? > > Thanking in advance, > > Valeria Lentini -- Regards, Mark D'Souza -- for the MG-RAST team mg-rast(a)mcs.anl.gov http://metagenomics.anl.gov/ If you need to respond to this email please address it to the mailing-list mg-rast(a)mcs.anl.gov

1 0

Information
by Valeria Lentini 25 Feb '11

25 Feb '11

Dear MG-RAST Staff, I'm PhD from Italy, I'm working with metagenomic data and I have discovered MG-RAST. I just want to know how much time employ to analyse 1,500,000 sequences? Thanking in advance, Valeria Lentini

1 0

Fwd: help with MG-RAST ID search
by Mark D'Souza 25 Feb '11

25 Feb '11

----- Forwarded Message ----- > From: "Pengfei Song" <psong(a)oeb.harvard.edu> > To: "Mark D'Souza" <dsouza(a)mcs.anl.gov> > Sent: Friday, February 25, 2011 2:44:58 PM > Subject: RE: [mg-rast] help with MG-RAST ID search > That's great to know. Thank you so much. I'll contact the author to > ask her to share them with me. > Best, > Pengfei > ________________________________________ > From: Mark D'Souza [dsouza(a)mcs.anl.gov] > Sent: Friday, February 25, 2011 2:38 PM > To: Song, Pengfei > Cc: mg-rast(a)mcs.anl.gov > Subject: Re: [mg-rast] help with MG-RAST ID search > > Hi Pengfei, > > The dataset you describe was run on MG-RAST version 1, but it has not > been made public so you are not able to see it. You will need to > request the author to make it public. This is done through the 'Jobs > Overview' page on the website by clicking on the 'view details' link > for the job. The resulting 'Job Details' page has a 'Make this > metagenome publicly accessible' link. > > ----- Original Message ----- > > From: "Pengfei Song" <psong(a)oeb.harvard.edu> > > To: mg-rast(a)mcs.anl.gov > > Sent: Friday, February 25, 2011 10:58:29 AM > > Subject: [mg-rast] help with MG-RAST ID search > > Dear friend, > > > > I have been a user of MG-RAST for about 2 years, but still struggle > > to > > find comparable metagenomes to my samples. I wonder how you can find > > a > > publicly accessible metagenome (the author said it is available on > > MG-RAST) from your website when the only information I know is > > below: > > > > Authors: Jennifer Biddle, Sorel Fitz-Gibbon, Stephan Schuster, Jean > > Brenchley, Christopher House > > Journal: PNAS, 2008 > > Title: Metagenomic signatures of the Peru Margin subseafloor > > biosphere > > show a genetically distinct environment > > Possible sample name: 1mbsf-original.fna > > > > Many many thanks for your time! > > > > Sincerely, > > Pengfei Song > > Postdoctoral Associate > > -- > Regards, > Mark D'Souza > -- for the MG-RAST team > > mg-rast(a)mcs.anl.gov > http://metagenomics.anl.gov/ > > If you need to respond to this email please address it to the > mailing-list mg-rast(a)mcs.anl.gov

1 0

Re: [mg-rast] help with MG-RAST ID search
by Mark D'Souza 25 Feb '11

25 Feb '11

Hi Pengfei, The dataset you describe was run on MG-RAST version 1, but it has not been made public so you are not able to see it. You will need to request the author to make it public. This is done through the 'Jobs Overview' page on the website by clicking on the 'view details' link for the job. The resulting 'Job Details' page has a 'Make this metagenome publicly accessible' link. ----- Original Message ----- > From: "Pengfei Song" <psong(a)oeb.harvard.edu> > To: mg-rast(a)mcs.anl.gov > Sent: Friday, February 25, 2011 10:58:29 AM > Subject: [mg-rast] help with MG-RAST ID search > Dear friend, > > I have been a user of MG-RAST for about 2 years, but still struggle to > find comparable metagenomes to my samples. I wonder how you can find a > publicly accessible metagenome (the author said it is available on > MG-RAST) from your website when the only information I know is below: > > Authors: Jennifer Biddle, Sorel Fitz-Gibbon, Stephan Schuster, Jean > Brenchley, Christopher House > Journal: PNAS, 2008 > Title: Metagenomic signatures of the Peru Margin subseafloor biosphere > show a genetically distinct environment > Possible sample name: 1mbsf-original.fna > > Many many thanks for your time! > > Sincerely, > Pengfei Song > Postdoctoral Associate -- Regards, Mark D'Souza -- for the MG-RAST team mg-rast(a)mcs.anl.gov http://metagenomics.anl.gov/ If you need to respond to this email please address it to the mailing-list mg-rast(a)mcs.anl.gov

1 0

Re: [mg-rast] The MG-RAST update?
by Mark D'Souza 25 Feb '11

25 Feb '11

Hi, The beta site access information is below. Regards, Mark The beta site is currently read only and you can view the analyses available for a number of precomputed data sets. We will send out an email when we make the site fully functional with processing of new uploaded data sets in the near future. While your username and password are identical to the current one used in version 2, there is a second username/password controlling access to the beta site: username: beta password: tester Click here to log on: http://test.metagenomics.anl.gov We request that you direct your feedback to: mg-rast-beta(a)mcs.anl.gov. ----- Original Message ----- > From: "Thomas Haverkamp" <t.h.a.haverkamp(a)bio.uio.no> > To: "Folker Meyer" <folker(a)anl.gov> > Cc: mg-rast(a)mcs.anl.gov > Sent: Friday, February 25, 2011 7:11:38 AM > Subject: Re: [mg-rast] The MG-RAST update? > Hi Folker, > Thanks for the quick reponse. > > > On Fri, Feb 25, 2011 at 1:56 PM, Folker Meyer < folker(a)anl.gov > > wrote: > > > Thomas: > > there is a beta program available now. we are still making some > changes, but the beta is almost complete. > > > Looking forward to the test this. > > > > Mark will send you access info for the beta. We plan on releasing by > March 8th. > > > This is great. I will try to test it an incorporate this in my lecture > in april. > > > > I do not know what you mean about not having to upload, version 3.0 > still requires data upload, and accepts more formats. > (You might be talking about the CLOUD computing feature, that enables > the use of local computational resources if MG-RAST is slow.?) > > > I also assume that is what I meant. I think the cloud feature would be > very good to have. > > > > The beta has some info on what has changed from version 2.0 > > Best, > FOlker > > > > > > > Cheers > Thomas > > > > > On Feb 25, 2011, at 6:50 AM, Thomas Haverkamp wrote: > > > Hi, > > I am involved in a course on analysis of metagenomes and I am going > > to explain about MG-RAST. As I know that MG-RAST is undergoing > > revision, I was hoping to find out when this revision is going > > online. > > The course in which I teach is due for early april, and it would be > > quite stupid to show people the old MG-RAST if the newest version of > > MG-RAST is already running. Also, I would like to know what is > > different in the new version of MG-RAST. I heard the last time I was > > at Argonne, that you don't have to upload your data anymore to > > MG-RAST but that you can still use the databases for annotation. But > > what else is different? > > > > Could you help me here? > > Cheers > > Thomas

1 0

Fwd: Status of job 11044
by Mark D'Souza 25 Feb '11

25 Feb '11

----- Forwarded Message ----- > From: "Matthew T. Cottrell" <mattcott(a)udel.edu> > To: "Mark D'Souza" <dsouza(a)mcs.anl.gov> > Sent: Friday, February 25, 2011 11:11:49 AM > Subject: Re: [mg-rast] Status of job 11044 > Mark, > > Thanks for the heads up about my email address. It is now updated. > > Yeah, I had uploaded two broken files, but now that's fixed with a > good file. Thanks for cleaning up after me. > > Matt > > On Feb 25, 2011, at 11:55 AM, Mark D'Souza wrote: > > > Hi, > > > > It appears that we do not have your correct email address in the > > MG-RAST system, which means you will not get the automated messages > > about your jobs. If this is right and you wish to correct this, > > please login to the system, click on the 'two-heads' icon in the top > > right corner of the browser page and change the email address > > listed. > > > > I was actually wanting to email you about the two failed jobs from > > yesterday, the jobs failed as the .tgz tar archive contained a file > > labelled .fasta which is gzipped, I will delete these. The other > > jobs are running normally and are queued for similarity computation. > > > > -- > > Regards, > > Mark D'Souza > > -- for the MG-RAST team > > > > mg-rast(a)mcs.anl.gov > > http://metagenomics.anl.gov/ > > > > If you need to respond to this email please address it to the > > mailing-list mg-rast(a)mcs.anl.gov > > > > > > ----- Original Message ----- > >> From: "Matthew T. Cottrell" <mattcott(a)UDel.Edu> > >> To: dsouza(a)mcs.anl.gov > >> Sent: Tuesday, October 12, 2010 7:02:21 AM > >> Subject: Re: [mg-rast] Status of job 11044 > >> Thanks for the head up my job status. > >> > >> Matt > >> > >> > >> On Oct 12, 2010, at 3:28 AM, dsouza(a)mcs.anl.gov wrote: > >> > >>> Hi, > >>> > >>> Your jobs should be done within a day. They were queued for > >>> similarity computation which takes a substantial amount of time > >>> with > >>> over ten Gbp sequence data in the queue. This step has now been > >>> completed and the rest of the steps in the pipeline should > >>> complete > >>> soon. > >>> > >>> > >>> ----- "Matthew T. Cottrell" <mattcott(a)UDel.Edu> wrote: > >>> > >>>> From: "Matthew T. Cottrell" <mattcott(a)UDel.Edu> > >>>> To: mg-rast(a)mcs.anl.gov > >>>> Sent: Monday, October 11, 2010 2:41:41 PM GMT -06:00 US/Canada > >>>> Central > >>>> Subject: [mg-rast] Status of job 11044 > >>>> > >>>> MG-RAST Team, > >>>> > >>>> Just curious about the status of my jobs submitted two weeks ago. > >>>> > >>>> There is a deadline I'm trying to meet before Thursday and > >>>> completion > >>>> of job 11044 would really help a lot. > >>>> > >>>> My other queued jobs (11038, 11042 and 11043) are lower priority > >>>> and > >>>> not necessary for that Thursday deadline. > >>>> > >>>> Thanks, > >>>> Matt > >>>> . . . . . . . . . . . . . . . . . . . . . . . _/) > >>>> Matthew T. Cottrell, Ph. D. > >>>> Associate Scientist > >>>> University of Delaware > >>>> School of Marine Science and Policy > >>>> 700 Pilottown Rd. > >>>> Lewes, DE 19958 > >>>> > >>>> 302 645-4383 (office); 302 430-3489 (mobile); 302 645-4007 (fax) > >>>> http://www.ceoe.udel.edu/people/mattcott > >>> > >>> -- > >>> Regards, > >>> Mark D'Souza > >>> -- for the MG-RAST team > >>> > >>> mg-rast(a)mcs.anl.gov > >>> http://metagenomics.anl.gov/ > >>> > >>> If you need to respond to this email please address it to the > >>> mailing-list mg-rast(a)mcs.anl.gov > >> > >> . . . . . . . . . . . . . . . . . . . . . . . _/) > >> Matthew T. Cottrell, Ph. D. > >> Associate Scientist > >> University of Delaware > >> School of Marine Science and Policy > >> 700 Pilottown Rd. > >> Lewes, DE 19958 > >> > >> 302 645-4383 (office); 302 430-3489 (mobile); 302 645-4007 (fax) > >> http://www.ceoe.udel.edu/people/mattcott > > . . . . . . . . . . . . . . . . . . . . . . . _/) > Matthew T. Cottrell, Ph. D. > Associate Scientist > University of Delaware > School of Marine Science and Policy > 700 Pilottown Rd. > Lewes, DE 19958 > > 302 645-4383 (office); 302 430-3489 (mobile); 302 645-4007 (fax) > http://www.ceoe.udel.edu/people/mattcott

1 0

Your MG-RAST jobs (14774 i4 and 14775 rhamnosus annotation)
by Mark D'Souza 25 Feb '11

25 Feb '11

Hi, The jobs you submitted to MG-RAST (14774 i4 and 14775 rhamnosus annotation) have both failed. The sequence file for both ended in: ... >contig3099 TACAGCTTTCCATTCGCTACGCAGAATTACACCGCTCAGAAAACTGCCGCGCCGACGAATCTTTTTAGCTGGTGCCACCCAGGATCCGGAACATG >contig3100 where the last sequence identifier is not followed by a sequence. Please check that your sequence file was not truncated and edit if necessary to remove the last sequence identifier before resubmitting to the MG-RAST server. -- Regards, Mark D'Souza -- for the MG-RAST team mg-rast(a)mcs.anl.gov http://metagenomics.anl.gov/ If you need to respond to this email please address it to the mailing-list mg-rast(a)mcs.anl.gov

1 0

Re: [mg-rast] help with MG-RAST ID search
by Folker Meyer 25 Feb '11

25 Feb '11

Dear Pengfei, we are looking into this. There is some hope for you since version 3.0 will support rich metadata. Release date is before march 8th 2011 Best, Folker On Feb 25, 2011, at 10:54 AM, Song, Pengfei wrote: > Dear Dr. Meyer, > > I have been a user of MG-RAST for about 2 years, but still struggle to find comparable metagenomes to my samples. I wonder how you can find a publicly accessible metagenome (the author said it is available on MG-RAST) from your website when the only information I know is below: > > Authors: Jennifer Biddle, Sorel Fitz-Gibbon, Stephan Schuster, Jean Brenchley, Christopher House > Journal: PNAS, 2008 > Title: Metagenomic signatures of the Peru Margin subseafloor biosphere show a genetically distinct environment > Possible sample name: 1mbsf-original.fna > > Many many thanks for your time! > > Sincerely, > Pengfei Song > Postdoctoral Associate

1 0