June 2011 - Mg-rast - mailman3.cels.anl.gov

Job's been running for 2 weeks+
by Cleo HC Ho 27 Jun '11

27 Jun '11

Hi, I uploaded a metagenome about two weeks ago, and it is still running right now. Because it usually doesn't take this long, I'm wondering if there's anything wrong with the process (or my data). The job ID is 4465534.3, and the name is "Methanogenic Benzene (phrap with debris)." Could you please let me know if anything's wrong with it, and perhaps why it is taking long? Thank you very much. Regards, Cleo Ho

1 0

question about sequence hits
by Mirjam Perner 27 Jun '11

27 Jun '11

Dear madame, dear sir, just a very brief question: I have uploaded 147,867 sequences (sequence count) with roughly 400 bp, but when comparing these sequences with the M5NR databse I get a total of 188,640 number of reads hit. how can I have more hits than uploaded sequences? The other databases, Genbank etc dont have this problem Thanks, for your time Mirjam -- (jun.) Prof. Dr. Mirjam Perner Microbiology& Biotechnology University of Hamburg room 3155/3156 Ohnhorststr. 18 22609 Hamburg Germany Tel.: ++49(0) 40 42816 444 (Monday-Thursday) Tel.: ++49(0) 40 42838 6006 (fridays) Fax: ++49(0) 40 42816 459 Email: mirjam.perner(a)uni-hamburg.de http://www.genmibio.de/html/ag_perner.html http://www.chemie.uni-hamburg.de/lexi/gsc1chem/Principal_Investigators_Proj…

1 0

Re: [mg-rast] request
by William Trimble 27 Jun '11

27 Jun '11

Thanks for using MG-RAST. You need to send the COG proteins to the workbench. http://blog.metagenomics.anl.gov/howto/using-the-workbench/ On the workbench page, below the table, is a button labeled download metagenome dna FASTA annotated by COG, which generates a fasta file like this: >4440275.3|228555_3152_1807|COG|COG0489 ATPases involved in chromosome partitioning catctaataaagcaacatcttgaggtgttgaatacaataacagcacccgctaaatttact tgttgtgccaatgatatctgtatatctccagtcccaggtggaagatcaataataattata tctaaattgccccatgctacagaatttagcatttgagttaaggcagactgtaccataggt cctcgccaaatcattgctgtgtcgtcaggaactaatagccccatagacatcaaacttatt cctaaaa >4440275.3|318862_2493_3356|COG|COG1192 ATPases involved in chromosome partitioning ggcactcacgttgagccccgatttatacaaaaaacagatattgaaaatatcgatcttgtc containing the sequences that had similarity matches. I hope this helps. William Trimble for the MG-RAST team ---------- Forwarded message ---------- From: <Dongmei.Li(a)csiro.au> Date: Mon, Jun 27, 2011 at 3:23 AM Subject: [mg-rast] request To: mg-rast(a)mcs.anl.gov Dear Sir/Madam,**** ** ** Sorry to bother you . **** I am using COG analysis in MG-RAST, for example, I have got the information below:**** metagenome**** level 1**** level 2**** function**** id**** abundance**** avg eValue**** avg % ident**** avg align len**** # proteins**** *4448084.3* *CELLULAR PROCESSES AND SIGNALING* *Cell cycle control, cell division, chromosome partitioning * *Integral membrane protein possibly involved in chromosome condensation* *COG0239* *112* *-12.5* *74.38* *48.79* *14* ** ** My question is whether I can get the information about which reads of the 454 sequences are assigned to COG0239?**** ** ** Thank you in advance,**** ** ** Regards,**** Dongmei**** ** ** *Dr. Dongmei Li* Research Scientist*|* MEOR CSIRO Food & Nutritional Sciences**** Phone: +61 2 9490 5078* | *Fax: +61 2 9490 5010 dongmei.li(a)csiro.au *|* www.csiro.au *|* www.csiro.au/CFNS Address: 11 Julius Ave. North Ryde,NSW 2113 **** *PLEASE NOTE* The information contained in this email may be confidential or privileged. Any unauthorised use or disclosure is prohibited. If you have received this email in error, please delete it immediately and notify the sender by return email. Thank you. To the extent permitted by law, CSIRO does not represent, warrant and/or guarantee that the integrity of this communication has been maintained or that the communication is free of errors, virus, interception or interference. **** *Please consider the environment before printing this email.***** ** **

1 0

Re: [mg-rast] Hits and minimum length
by William Trimble 27 Jun '11

27 Jun '11

Thanks for using MG-RAST. The similarity searching step in MG-RAST isn't specifically designed to identify chimeras. It performs a similarity search and allows you to filter the results of the search. It could be chimerism, but it could just be that the best database hits don't align particularly well. On the face of it, it makes sense that more stringent filters will yield fewer species and fewer hits. I haven't been able to reproduce the numbers you report below -- which dataset are you using, and which annotation source (RDP, greengenes, or SSU)? Where are you taking the "abundance" number from? William Trimble for the MG-RAST team On Mon, Jun 27, 2011 at 2:00 AM, Peter Ahrens <PAE(a)ssi.dk> wrote: > > > I am examining a sample of 8150 16S sequences to the species level. > When I change the minimum alignment length cut off, the results changes > dramatically: > > LENGTH / SPECIES / TOTAL NUMBER OF HITS > > 150 / 23 / 13576 > > 200 / 21 / 13537 > > 250 / 19 / 11907 > > 275 / 14 / 6245 > > 300 / 14 / 5097 > > > The average length of my sequences is approximately 400 bases. > > Does the high number of hits with the 150 setting indicate chimeras? Or why > will 8150 sequences give a total of 13576 hits? > > > > > > Thanks in advance > > > > Peter > > > > > > > > > > > > > > > > ***************** > > Peter Ahrens > > STI Research > > AMOF > > Build. 43/405A > > Statens Serum Institut > > Ørestads Boulevard 5 > > DK-2300 > > Copenhagen > > Denmark > > ***************** > > > > ________________________________ > > STATENS SERUM INSTITUT - 5, Orestads Boulevard - DK-2300 Copenhagen S > > Tel: +45 3268 3268 - Fax: +45 3268 3868 > > serum(a)ssi.dk www.ssi.dk > > ________________________________ > > This e-mail, inclusive of attachments, is intended for the person(s) or > entity stated above and may contain confidential information. Unauthorised > reading, disclosure, copying, distribution or use of this information may > violate rights to proprietary information. If you are not an intended > recipient, please return this e-mail to the sender and delete your copy. > Thank you. > >

1 0

request
by Dongmei.Li＠csiro.au 27 Jun '11

27 Jun '11

Dear Sir/Madam, Sorry to bother you . I am using COG analysis in MG-RAST, for example, I have got the information below: metagenome level 1 level 2 function id abundance avg eValue avg % ident avg align len # proteins 4448084.3 CELLULAR PROCESSES AND SIGNALING Cell cycle control, cell division, chromosome partitioning Integral membrane protein possibly involved in chromosome condensation COG0239 112 -12.5 74.38 48.79 14 My question is whether I can get the information about which reads of the 454 sequences are assigned to COG0239? Thank you in advance, Regards, Dongmei Dr. Dongmei Li Research Scientist| MEOR CSIRO Food & Nutritional Sciences Phone: +61 2 9490 5078 | Fax: +61 2 9490 5010 dongmei.li(a)csiro.au | www.csiro.au | www.csiro.au/CFNS Address: 11 Julius Ave. North Ryde,NSW 2113 PLEASE NOTE The information contained in this email may be confidential or privileged. Any unauthorised use or disclosure is prohibited. If you have received this email in error, please delete it immediately and notify the sender by return email. Thank you. To the extent permitted by law, CSIRO does not represent, warrant and/or guarantee that the integrity of this communication has been maintained or that the communication is free of errors, virus, interception or interference. Please consider the environment before printing this email.

1 0

Hits and minimum length
by Peter Ahrens 27 Jun '11

27 Jun '11

I am examining a sample of 8150 16S sequences to the species level. When I change the minimum alignment length cut off, the results changes dramatically: LENGTH / SPECIES / TOTAL NUMBER OF HITS 150 / 23 / 13576 200 / 21 / 13537 250 / 19 / 11907 275 / 14 / 6245 300 / 14 / 5097 The average length of my sequences is approximately 400 bases. Does the high number of hits with the 150 setting indicate chimeras? Or why will 8150 sequences give a total of 13576 hits? Thanks in advance Peter ***************** Peter Ahrens STI Research AMOF Build. 43/405A Statens Serum Institut Ørestads Boulevard 5 DK-2300 Copenhagen Denmark ***************** ________________________________ STATENS SERUM INSTITUT - 5, Orestads Boulevard - DK-2300 Copenhagen S Tel: +45 3268 3268 - Fax: +45 3268 3868 serum(a)ssi.dk www.ssi.dk<http://www.ssi.dk> ________________________________ This e-mail, inclusive of attachments, is intended for the person(s) or entity stated above and may contain confidential information. Unauthorised reading, disclosure, copying, distribution or use of this information may violate rights to proprietary information. If you are not an intended recipient, please return this e-mail to the sender and delete your copy. Thank you.

1 0

Re: [mg-rast] Question about data in process
by Mark D'Souza 24 Jun '11

24 Jun '11

Hi, Sorry about that, the job had been run through a different analysis pipeline than the others in the set. We are redoing the analysis for this job and it should complete within a couple of days. Regards, Mark On Jun 22, 2011, at 11:26 AM, Mark DSouza wrote: > Hi Nicolas, > > We will look into this and get back to you. > > Regards, > Mark > > > ----- Original Message ----- >> From: "Nicolás Rascovan" <nicorascovan(a)soilgene.net> >> To: "Mark D'Souza" <dsouza(a)mcs.anl.gov> >> Cc: mg-rast(a)mcs.anl.gov >> Sent: Wednesday, June 22, 2011 11:04:36 AM >> Subject: Re: [mg-rast] Question about data in process >> Hi Mark or MG Rast team, >> >> I am having problems with one of our 11 metagenomes. It's ID is >> 4448638.3 (soilgene_NoAgro). It seems that it had somekind of problem >> during annotation. When I tried to compare all metagenomes at >> taxonomic level, it says that there is no information on taxonomy for >> that metagenome. And when I try to compare at functional level, there >> is something strange because when I use this data to compare using >> ecological metrics, the distance of this metagenome is much higher to >> the rest of them and that of any of the other metagenomes between them >> (and it shouldn't be this way according to metadata and results from >> v1.0 where results and distances where comparable to the rest of the >> metagenomes). >> >> I hope you can help us, >> >> Thanks, >> >> Nicolas. >> >> >> >> >> El 16 de junio de 2011 12:37, Nicolás Rascovan < >> nicorascovan(a)soilgene.net > escribió: >> >> >> Yes, I saw them... >> >> >> Thank you very much Mark and sorry for all the inconveniences, >> >> >> Nicolas. >> >> >> El 16 de junio de 2011 12:23, Mark D'Souza < dsouza(a)mcs.anl.gov > >> escribió: >> >> >> >> >> >> Hi Nicolas, the analysis for these jobs has completed, sorry for the >> delay. >> >> Regards, >> Mark >> >> >> >> >> >> >> On Jun 14, 2011, at 9:14 AM, Mark D'Souza wrote: >> >>> Hi Nicolas, I will check and get back to you. >>> Regards, >>> Mark >>> >>> >>> >>> On Jun 13, 2011, at 6:51 PM, Nicolás Rascovan wrote: >>> >>>> Hi Mark, >>>> >>>> Do you have an estimation on how long it might take the analysis of >>>> these three metagenomes? >>>> >>>> Thanks, >>>> >>>> Nicolas >>>> >>>> P.S: Sorry for insisting so much, but we are waiting for them to >>>> start the comparison of all our datasets.... >>>> >>>> El 10 de junio de 2011 17:32, Mark D'Souza < dsouza(a)mcs.anl.gov > >>>> escribió: >>>> Hi, >>>> >>>> Sorry about that, they did get restarted and got stuck again, we >>>> will restart them. >>>> >>>> Regards, >>>> Mark >>>> >>>> >>>> >>>> On Jun 10, 2011, at 2:26 PM, Nicolás Rascovan wrote: >>>> >>>>> Hi Mark, >>>>> >>>>> Sorry to bother you again. It's been a week since, according to >>>>> what you told me, the jobs should be finished. I wonder if they >>>>> got stuck again. >>>>> >>>>> Let me know how are things going with these processes... >>>>> >>>>> Thanks again, >>>>> >>>>> Nicolas >>>>> >>>>> El 2 de junio de 2011 18:42, Mark D'Souza < dsouza(a)mcs.anl.gov > >>>>> escribió: >>>>> Hi, >>>>> >>>>> You are right, the jobs did get stuck without an error message, we >>>>> will restart them and they should complete within a day or two, >>>>> sorry for the delay. >>>>> >>>>> Regards, >>>>> Mark D'Souza >>>>> -- for the MG-RAST team >>>>> >>>>> mg-rast(a)mcs.anl.gov >>>>> http://metagenomics.anl.gov/ >>>>> >>>>> If you need to respond to this email please address it to the >>>>> mailing-list mg-rast(a)mcs.anl.gov >>>>> >>>>> >>>>> >>>>> >>>>> On Jun 1, 2011, at 7:22 PM, Nicolás Rascovan wrote: >>>>> >>>>>> Hi, >>>>>> >>>>>> I would like to ask you about 3 projects we have in progress. We >>>>>> had 9 metagenomes analyzed in the previous version of MG RAST and >>>>>> in the new one, only 6 of them have been finished. We were >>>>>> waiting for a couple of month, thinking that you might have lot >>>>>> of data to re analyze, but we are surprised that they have been >>>>>> in the same step since ever, so now we are wondering if maybe >>>>>> something failed and they got stucked there. >>>>>> >>>>>> I send you a screenshot of the samples that are in progress... >>>>>> >>>>>> Thanks a lot for your help, >>>>>> >>>>>> Nicolas Rascovan. >>>>>> >>>>>> <Screenshot_nicorasco.jpg> >>>>> >>>>> >>>> >>>> >>>

1 0

Re: [mg-rast] Status of Uploaded Sequences
by Mark DSouza 24 Jun '11

24 Jun '11

Ah, I see. If you a .fasta file and a .qual file you need to create a single archive file (zip or tar) containing both of them, the files stay separate within the archive. For a Unix like environment: tar cvzf archive.tgz file1.fasta file2.qual would work from the command line. For my Mac, in the Finder selecting two files and right clicking offers a 'Compress 2 Items' option to create the file Archive.zip, I suspect Windows will do something similar. Regards, Mark ----- Original Message ----- > From: "Matthew T. Cottrell" <mattcott(a)udel.edu> > To: "Mark D'Souza" <dsouza(a)mcs.anl.gov> > Sent: Friday, June 24, 2011 4:16:13 PM > Subject: Re: [mg-rast] Status of Uploaded Sequences > Mark, > > Maybe I'm confused by the instructions on the upload site. > > See the screenshot below. The instructions seem to suggest that I make > a single compressed file containing the .fasta and .qual files. So, > that's what I did. > > I'm confused. How do I upload the .fasta and .qual files if the > uploader takes only one file. > > Thanks, > Matt > > > > > On Jun 24, 2011, at 5:01 PM, Mark D'Souza wrote: > > > Hi, > > > > The uploaded file is not in FASTA format and can not be processed, > > it looks like it contains the concatenated FASTA and qual files: > > > > ... > >> GI4DNEO01B8AQS length=138 > > AACAGTTCGCCGTAGTACACCATCCGTGCCCAGGCTTCCGGGAAATAGGACTCATCAAGA > > CCGTTCTGGAAGGCGACCAGACGAATCTTATCCGCTTCAACCATTGAAAGTCAGGTGCTC > > TCGGACCTGTTGATGGCT > >> GI4DNEO01AKDNS length=68 > > 28 28 22 19 19 18 21 18 18 19 ... > > > > You will need to edit the file to remove the quality information and > > resubmit. > > > > Regards, > > Mark > > > > > > > > On Jun 24, 2011, at 9:53 AM, Mark DSouza wrote: > > > >> Hi, > >> > >> I will take a look and get back to you, > >> > >> -- > >> Regards, > >> Mark D'Souza > >> -- for the MG-RAST team > >> > >> mg-rast(a)mcs.anl.gov > >> http://metagenomics.anl.gov/ > >> > >> If you need to respond to this email please address it to the > >> mailing-list mg-rast(a)mcs.anl.gov > >> > >> > >> > >> ----- Original Message ----- > >>> From: "Matthew T. Cottrell" <mattcott(a)udel.edu> > >>> To: "Mark DSouza" <dsouza(a)mcs.anl.gov> > >>> Sent: Thursday, June 23, 2011 4:55:28 PM > >>> Subject: Status of Uploaded Sequences > >>> Mark, > >>> > >>> Yesterday about this time I uploaded sequences that appeared to > >>> have > >>> been processed just fine by the uploader, but now 24 h later there > >>> is > >>> still not job started. On the "Create job" tab the status is > >>> listed as > >>> "upload completed, processing started." Am I missing a step needed > >>> to > >>> kick this off? > >>> > >>> Thanks, > >>> Matt > >>> . . . . . . . . . . . . . . . . . . . . . . . _/) > >>> Matthew T. Cottrell, Ph. D. > >>> Associate Scientist > >>> University of Delaware > >>> School of Marine Science and Policy > >>> 700 Pilottown Rd. > >>> Lewes, DE 19958 > >>> > >>> 302 645-4383 (office); 302 430-3489 (mobile); 302 645-4007 (fax) > >>> http://www.ceoe.udel.edu/people/mattcott > > > > . . . . . . . . . . . . . . . . . . . . . . . _/) > Matthew T. Cottrell, Ph. D. > Associate Scientist > University of Delaware > School of Marine Science and Policy > 700 Pilottown Rd. > Lewes, DE 19958 > > 302 645-4383 (office); 302 430-3489 (mobile); 302 645-4007 (fax) > http://www.ceoe.udel.edu/people/mattcott

1 0

Re: [mg-rast] Status of Uploaded Sequences
by Mark D'Souza 24 Jun '11

24 Jun '11

Hi, The uploaded file is not in FASTA format and can not be processed, it looks like it contains the concatenated FASTA and qual files: ... >GI4DNEO01B8AQS length=138 AACAGTTCGCCGTAGTACACCATCCGTGCCCAGGCTTCCGGGAAATAGGACTCATCAAGA CCGTTCTGGAAGGCGACCAGACGAATCTTATCCGCTTCAACCATTGAAAGTCAGGTGCTC TCGGACCTGTTGATGGCT >GI4DNEO01AKDNS length=68 28 28 22 19 19 18 21 18 18 19 ... You will need to edit the file to remove the quality information and resubmit. Regards, Mark On Jun 24, 2011, at 9:53 AM, Mark DSouza wrote: > Hi, > > I will take a look and get back to you, > > -- > Regards, > Mark D'Souza > -- for the MG-RAST team > > mg-rast(a)mcs.anl.gov > http://metagenomics.anl.gov/ > > If you need to respond to this email please address it to the mailing-list mg-rast(a)mcs.anl.gov > > > > ----- Original Message ----- >> From: "Matthew T. Cottrell" <mattcott(a)udel.edu> >> To: "Mark DSouza" <dsouza(a)mcs.anl.gov> >> Sent: Thursday, June 23, 2011 4:55:28 PM >> Subject: Status of Uploaded Sequences >> Mark, >> >> Yesterday about this time I uploaded sequences that appeared to have >> been processed just fine by the uploader, but now 24 h later there is >> still not job started. On the "Create job" tab the status is listed as >> "upload completed, processing started." Am I missing a step needed to >> kick this off? >> >> Thanks, >> Matt >> . . . . . . . . . . . . . . . . . . . . . . . _/) >> Matthew T. Cottrell, Ph. D. >> Associate Scientist >> University of Delaware >> School of Marine Science and Policy >> 700 Pilottown Rd. >> Lewes, DE 19958 >> >> 302 645-4383 (office); 302 430-3489 (mobile); 302 645-4007 (fax) >> http://www.ceoe.udel.edu/people/mattcott

1 0

Re: [mg-rast] M5NR
by Mark D'Souza 24 Jun '11

24 Jun '11

Hi, The M5NR barchart display has been fixed, thanks for letting us know about the problem. Regards, Mark On Jun 24, 2011, at 10:15 AM, Mark D'Souza wrote: > Hi, > > You are right, it is not being displayed correctly, we will get it fixed and get back to you. > > Glad to hear that you find MG-RAST useful. > > Regards, > Mark D'Souza > -- for the MG-RAST team > > mg-rast(a)mcs.anl.gov > http://metagenomics.anl.gov/ > > If you need to respond to this email please address it to the mailing-list mg-rast(a)mcs.anl.gov > > > > > On Jun 23, 2011, at 8:01 PM, sophie.davidson(a)dpi.vic.gov.au wrote: > >> Hi, >> >> I am fiddling around with MG-RAST and have come across a bit of a problem when using M5NR as my annotation source. If I try generating a bar chart of any metagenomic data under the organism classification tab using this M5NR database, whether it's my own or a public dataset/s, I keep getting no bars in my graph - they are all zero! When I try selecting my group of annotation sources as all of the databases in the M5NR (i.e SwissProt, Genbank etc etc) then I get some lovely looking bars on my chart. I'm assuming this is a bug with the M5NR database since the organism classification using exactly the same databases all together result in a proper chart being generated, so I thought I'd pass this on. If it isn't a bug and I'm just not doing it properly then I apologise and look forward to getting the proper method from you guys! >> >> Other than this problem, so far I've found MG-RAST to be very valuable in my analysis, although it is only at the preliminary stages! So, thank you for producing such a user-friendly and robust program >> >> Cheers, >> Sophie Davidson >> >> >> Sophie Davidson | BioScience Researcher | BioScience Division >> Department of Primary Industries | Victorian AgriBiosciences Centre | 1 Park Dr | Bundoora VIC 3083 >> T: 03 9032 7111 | F: 03 9479 3618 | E: sophie.davidson(a)dpi.vic.gov.au >> >> >> Notice: >> This email and any attachments may contain information that is personal, confidential, >> legally privileged and/or copyright. No part of it should be reproduced, adapted or communicated without the prior written consent of the copyright owner. >> >> It is the responsibility of the recipient to check for and remove viruses. >> >> If you have received this email in error, please notify the sender by return email, delete it from your system and destroy any copies. You are not authorised to use, communicate or rely on the information contained in this email. >> >> Please consider the environment before printing this email. >> >> >> >> >

1 0